Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRMT7 cdna clone

PRMT7 cDNA Clone

Synonyms
PRMT7; PRMT7 cDNA Clone; PRMT7 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagatcttctgcagtcgggccaatccgaccacggggtctgtggagtggctggaggaggatgaacactatgattaccaccaggagattgcaaggtcatcttatgcagatatgctacatgacaaagacagaaatgtaaaatactaccaaggtatccgggctgccgtgagcagggtgaaggacagaggacagaaggccttggttctcgacattggcactggcacgggactcttgtcaatgatggcggtcacagcaggtgccgacttctgctatgccatcgaggttttcaagcctatggctgatgctgctgtgaagattgtggagaaaaatggctttagtgataagattaaggttatcaacaagcattccaccgaggtgactgtaggtccagagggtgacatgccatgccgtgccaacatcctggtcacagagttgtttgacacagagctgatcggggagggggcgctgccctcctatgagcacgcacacaggcatctcgtggaggaaaattgtgaggccgtgccccacagagccaccgtctatgcacagctggtggagtccgggaggatgtggtcgtggaacaagctatttcccatccacgtgcagaccagcctcggagagcaggtcatcgtccctcccgttgacgtggagagctgccctggcgcaccctctgtctgtgacattcagctgaaccaggtgtcaccagccgactttacagtcctcagcgatgtgctgcccatgttcagcatagacttcagcaagcaagtcagtagctcagcagcctgccatagcaggcggtttgaacctctgacatctggccgagctcaggtggttctctcgtggtgggacattgaaatggaccctgaggggaagatcaagtgcaccatggcccccttctgggcacactcagacccagaggagatgcagtggcgggaccactggatgcagtgtgtgtacttcctgccacaagaggagcctgtggtgcagggctcagcgctctatctggtagcccaccacgatgactactgcgtatggtacagcctgcagaggaccagccctgaaaagaatgagagagtccgccagatgcgccccgtgtgtgactgccaggctcacctgctctggaaccggcctcggtttggagagatcaatgaccaggacagaactgatcgatacgtccaggctctgaggaccgtgctgaagccagacagcgtgtgcctgtgtgtcagcgatggcagcctgctctccgtgctggcccatcacctgggggtggagcaggtgtttacagtcgagagttcagcagcttctcacaaactgttgagaaaaatcttcaaggctaaccacttggaagataaaattaacatcatagagaaacggccggaattattaacaaatgaggacctacagggcagaaaggtctctctcctcctgggcgagccgttcttcactaccagcctgctgccgtggcacaacctctacttctggtacgtgcggaccgctgtggaccagcacctggggccaggtgccatggtgatgccccaggcagcctcgctgcacgctgtggttgtggagttcagggacctgtggcggatccggagcccctgtggtgactgcgaaggcttcgacgtgcacatcatggacgacatgattaagcgtgccctggacttcagggagagcagggaagctgagccccacccgctgtgggagtacccatgccgcagcctctccgagccctggcagatcctgacctttgacttccagcagccggtgcccctgcagcccctgtgtgccgagggcactgtggagctcagaaggcccgggcagagccacgcagcggtgctatggatggagtaccacctgaccccggagtgcacgctcagcactggcctcctggagcctgcagaccccgaggggggctgctgctggaacccccactgcaagcaggccgtctacttcttcagccctgccccagatcccagagcactgctgggtggcccacggactgtcagctatgcagtggagtttcaccccgacacaggcgacatcatcatggagttcaggcatgcagataccccagactga
Sequence Length
2079
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,806 Da
NCBI Official Full Name
Homo sapiens protein arginine methyltransferase 7, mRNA
NCBI Official Synonym Full Names
protein arginine methyltransferase 7
NCBI Official Symbol
PRMT7
NCBI Protein Information
protein arginine N-methyltransferase 7
UniProt Protein Name
Protein arginine N-methyltransferase 7
UniProt Gene Name
PRMT7
UniProt Synonym Gene Names
KIAA1933
UniProt Entry Name
ANM7_HUMAN

NCBI Description

Arginine methylation is an apparently irreversible protein modification catalyzed by arginine methyltransferases, such as PMT7, using S-adenosylmethionine (AdoMet) as the methyl donor. Arginine methylation is implicated in signal transduction, RNA transport, and RNA splicing (Miranda et al., 2004 [PubMed 15044439]).[supplied by OMIM, Mar 2008]

Uniprot Description

PRMT7: Arginine methyltransferase that can both catalyze the formation of omega-N monomethylarginine (MMA) and symmetrical dimethylarginine (sDMA), with a preference for the formation of MMA. Specifically mediates the symmetrical dimethylation of arginine residues in the small nuclear ribonucleoproteins Sm D1 (SNRPD1) and Sm D3 (SNRPD3); such methylation being required for the assembly and biogenesis of snRNP core particles. Specifically mediates the symmetric dimethylation of histone H4 'Arg-3' to form H4R3me2s. Plays a role in gene imprinting by being recruited by CTCFL at the H19 imprinted control region (ICR) and methylating histone H4 to form H4R3me2s, possibly leading to recruit DNA methyltransferases at these sites. May also play a role in embryonic stem cell (ESC) pluripotency. Also able to mediate the arginine methylation of histone H2A and myelin basic protein (MBP) in vitro; the relevance of such results is however unclear in vivo. Belongs to the protein arginine N-methyltransferase family. PRMT7 subfamily. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase, protein arginine; RNA processing; EC 2.1.1.125; Methyltransferase; EC 2.1.1.126

Chromosomal Location of Human Ortholog: 16q22.1

Cellular Component: cytosol; nucleolus; nucleoplasm; nucleus

Molecular Function: [myelin basic protein]-arginine N-methyltransferase activity; histone binding; histone-arginine N-methyltransferase activity; protein-arginine N-methyltransferase activity; protein-arginine omega-N asymmetric methyltransferase activity; protein-arginine omega-N monomethyltransferase activity; protein-arginine omega-N symmetric methyltransferase activity; ribonucleoprotein binding; S-adenosylmethionine-dependent methyltransferase activity

Biological Process: DNA methylation during gametogenesis; genetic imprinting; histone methylation; peptidyl-arginine methylation; regulation of protein binding; regulation of transcription, DNA-dependent; spliceosomal snRNP biogenesis

Research Articles on PRMT7

Similar Products

Product Notes

The PRMT7 prmt7 (Catalog #AAA1267824) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagatct tctgcagtcg ggccaatccg accacggggt ctgtggagtg gctggaggag gatgaacact atgattacca ccaggagatt gcaaggtcat cttatgcaga tatgctacat gacaaagaca gaaatgtaaa atactaccaa ggtatccggg ctgccgtgag cagggtgaag gacagaggac agaaggcctt ggttctcgac attggcactg gcacgggact cttgtcaatg atggcggtca cagcaggtgc cgacttctgc tatgccatcg aggttttcaa gcctatggct gatgctgctg tgaagattgt ggagaaaaat ggctttagtg ataagattaa ggttatcaac aagcattcca ccgaggtgac tgtaggtcca gagggtgaca tgccatgccg tgccaacatc ctggtcacag agttgtttga cacagagctg atcggggagg gggcgctgcc ctcctatgag cacgcacaca ggcatctcgt ggaggaaaat tgtgaggccg tgccccacag agccaccgtc tatgcacagc tggtggagtc cgggaggatg tggtcgtgga acaagctatt tcccatccac gtgcagacca gcctcggaga gcaggtcatc gtccctcccg ttgacgtgga gagctgccct ggcgcaccct ctgtctgtga cattcagctg aaccaggtgt caccagccga ctttacagtc ctcagcgatg tgctgcccat gttcagcata gacttcagca agcaagtcag tagctcagca gcctgccata gcaggcggtt tgaacctctg acatctggcc gagctcaggt ggttctctcg tggtgggaca ttgaaatgga ccctgagggg aagatcaagt gcaccatggc ccccttctgg gcacactcag acccagagga gatgcagtgg cgggaccact ggatgcagtg tgtgtacttc ctgccacaag aggagcctgt ggtgcagggc tcagcgctct atctggtagc ccaccacgat gactactgcg tatggtacag cctgcagagg accagccctg aaaagaatga gagagtccgc cagatgcgcc ccgtgtgtga ctgccaggct cacctgctct ggaaccggcc tcggtttgga gagatcaatg accaggacag aactgatcga tacgtccagg ctctgaggac cgtgctgaag ccagacagcg tgtgcctgtg tgtcagcgat ggcagcctgc tctccgtgct ggcccatcac ctgggggtgg agcaggtgtt tacagtcgag agttcagcag cttctcacaa actgttgaga aaaatcttca aggctaacca cttggaagat aaaattaaca tcatagagaa acggccggaa ttattaacaa atgaggacct acagggcaga aaggtctctc tcctcctggg cgagccgttc ttcactacca gcctgctgcc gtggcacaac ctctacttct ggtacgtgcg gaccgctgtg gaccagcacc tggggccagg tgccatggtg atgccccagg cagcctcgct gcacgctgtg gttgtggagt tcagggacct gtggcggatc cggagcccct gtggtgactg cgaaggcttc gacgtgcaca tcatggacga catgattaag cgtgccctgg acttcaggga gagcagggaa gctgagcccc acccgctgtg ggagtaccca tgccgcagcc tctccgagcc ctggcagatc ctgacctttg acttccagca gccggtgccc ctgcagcccc tgtgtgccga gggcactgtg gagctcagaa ggcccgggca gagccacgca gcggtgctat ggatggagta ccacctgacc ccggagtgca cgctcagcac tggcctcctg gagcctgcag accccgaggg gggctgctgc tggaaccccc actgcaagca ggccgtctac ttcttcagcc ctgccccaga tcccagagca ctgctgggtg gcccacggac tgtcagctat gcagtggagt ttcaccccga cacaggcgac atcatcatgg agttcaggca tgcagatacc ccagactga. It is sometimes possible for the material contained within the vial of "PRMT7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.