Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UTY cdna clone

UTY cDNA Clone

Gene Names
UTY; UTY1; KDM6AL
Synonyms
UTY; UTY cDNA Clone; UTY cdna clone
Ordering
For Research Use Only!
Sequence
atgaaatcgtgcgcagtgtcgctcactaccgccgctgttgccttcggtgatgaggcaaagaaaatggcggaaggaaaagcgagccgcgagagtgaagaggagtctgttagcctgacagtcgaggaaagggaggcgcttggtggcatggacagccgtctcttcgggttcgtgaggcttcatgaagatggcgccagaacgaagaccctactaggcaaggtaaaagcaaccagacgcaaagtctttggtccgcactttgctctaccaaggccccgcgttccttaccgcccagccagtatttattttggctctgctccatggccaaggggtcggaaaagtgtttcttgcctttgctgtccccgtactctggaatacttcgccccttgctccagactcccttctactctgaggaaaaaaaaaatcggacgctttgggaccgggctaaaccgggtctacaccacatgcctgttactttag
Sequence Length
474
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
134,762 Da
NCBI Official Full Name
Homo sapiens ubiquitously transcribed tetratricopeptide repeat gene, Y-linked, mRNA
NCBI Official Synonym Full Names
ubiquitously transcribed tetratricopeptide repeat containing, Y-linked
NCBI Official Symbol
UTY
NCBI Official Synonym Symbols
UTY1; KDM6AL
NCBI Protein Information
histone demethylase UTY
UniProt Protein Name
Histone demethylase UTY
Protein Family
UniProt Gene Name
UTY
UniProt Synonym Gene Names
KDM6C
UniProt Entry Name
UTY_HUMAN

NCBI Description

This gene encodes a protein containing tetratricopeptide repeats which are thought to be involved in protein-protein interactions. The encoded protein is also a minor histocompatibility antigen which may induce graft rejection of male stem cell grafts. A large number of alternatively spliced transcripts have been observed for this gene, but the full length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2012]

Uniprot Description

UTY: Histone demethylase. Belongs to the UTX family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell surface; EC 1.14.11.-; Oxidoreductase

Chromosomal Location of Human Ortholog: Yq11

Cellular Component: nucleoplasm

Molecular Function: histone demethylase activity

Research Articles on UTY

Similar Products

Product Notes

The UTY uty (Catalog #AAA1267815) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaatcgt gcgcagtgtc gctcactacc gccgctgttg ccttcggtga tgaggcaaag aaaatggcgg aaggaaaagc gagccgcgag agtgaagagg agtctgttag cctgacagtc gaggaaaggg aggcgcttgg tggcatggac agccgtctct tcgggttcgt gaggcttcat gaagatggcg ccagaacgaa gaccctacta ggcaaggtaa aagcaaccag acgcaaagtc tttggtccgc actttgctct accaaggccc cgcgttcctt accgcccagc cagtatttat tttggctctg ctccatggcc aaggggtcgg aaaagtgttt cttgcctttg ctgtccccgt actctggaat acttcgcccc ttgctccaga ctcccttcta ctctgaggaa aaaaaaaatc ggacgctttg ggaccgggct aaaccgggtc tacaccacat gcctgttact ttag. It is sometimes possible for the material contained within the vial of "UTY, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.