Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NLN cdna clone

NLN cDNA Clone

Gene Names
NLN; MEP; MOP; AGTBP; EP24.16
Synonyms
NLN; NLN cDNA Clone; NLN cdna clone
Ordering
For Research Use Only!
Sequence
atgatcgcccggtgccttttggctgtgcgaagcctccgcagagttggtggttccaggattttactcagaatgacgttaggaagagaagtgatgtctcctcttcaggcaatgtcttcctatactgtggctggcagaaatgttttaagatgggatctttcaccagagcaaattaaaacaagaactgaggagctcattgtgcagaccaaacaggtgtacgatgctgttggaatgctcggtattgaggaagtaacttacgagaactgtctgcaggcactggcagatgtagaagtaaagtatatagtggaaaggaccatgctagactttccccagcatgtatcctctgacaaagaagtacgagcagcaagtacagaagcagacaaaagactttctcgttttgatattgagatgagcatgagaggagatatatttgagagaattgttcatttacaggaaacctgtgatctggggaagataaaacctgaggccagacgatacttggaaaagtcaattaaaatggggaaaagaaatgggctccatcttcctgaacaagtacagaatgaaatcaaatcaatgaagaaaagaatgagtgagctatgtattgattttaacaaaaacctcaatgaggatgataccttccttgtattttccaaggctgaacttggtgctcttcctcatgatttcattgacagtttagaaaagacagatgatgacaagtataaaattaccttaaaatatccacactatttccctgtcatgaagaaatgttgtatccctgaaaccagaagaaggatggaaatggcttttaatacaaggtgcaaagaggaaaacaccataattttgcagcagctactcccactgcgaaccaaggtggccaaactactcggttatagcacacatgctgacttcgtccttgaaatgaacactgcaaagagcacaagccgcgtaacagcctttctagatgatttaagccagaagttaaaacccttgggtgaagcagaacgagagtttattttgaatttgaagaaaaaggaatgcaaagacaggggttttgaatatgatgggaaaatcaatgcctgggatctatattactacatgactcagacagaggaactcaagtattccatagaccaagagttcctcaaggaatacttcccaattgaggtggtcactgaaggcttgctgaacacctaccaggagttgttgggactttcatttgaacaaatgacagatgctcatgtttggaacaagagtgttacactttatactgtgaaggataaagctacaggagaagtattgggacagttctatttggacctctatccaagggaaggaaaatacaatcatgcggcctgcttcggtctccagcctggctgccttctgcctgatggaagccggatgatggcagtggctgccctcgtggtgaacttctcacagccagtggcaggtcgtccctctctcctgagacacgacgaggtgaggacttactttcatgagtttggtcacgtgatgcatcagatttgtgcacaggtgagttttttttttcccccagtaaacctgccaattagtttttttagaaaacttcttgactgctgtcaggtttctgctcctaacaggttttttcagaagctgaatgtgttcaagaattttataggccttctgcaaaaccaaaattttccttatcctgtcctctttcacaacatatttttacttggaggttcatctaccagtgaaagatgtttgttgaataacagcctatggaaaaagaataagactatctgtaaggaaaggttacaaatactttgctttttccttttaatcctttag
Sequence Length
1824
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
80,652 Da
NCBI Official Full Name
Homo sapiens neurolysin (metallopeptidase M3 family), mRNA
NCBI Official Synonym Full Names
neurolysin
NCBI Official Symbol
NLN
NCBI Official Synonym Symbols
MEP; MOP; AGTBP; EP24.16
NCBI Protein Information
neurolysin, mitochondrial
UniProt Protein Name
Neurolysin, mitochondrial
Protein Family
UniProt Gene Name
NLN
UniProt Synonym Gene Names
AGTBP; KIAA1226; MEP
UniProt Entry Name
NEUL_HUMAN

NCBI Description

This gene encodes a member of the metallopeptidase M3 protein family that cleaves neurotensin at the Pro10-Tyr11 bond, leading to the formation of neurotensin(1-10) and neurotensin(11-13). The encoded protein is likely involved in the termination of the neurotensinergic signal in the central nervous system and in the gastrointestinal tract.[provided by RefSeq, Jun 2010]

Uniprot Description

NLN: Hydrolyzes oligopeptides such as neurotensin, bradykinin and dynorphin A. Belongs to the peptidase M3 family.

Protein type: Mitochondrial; Protease; EC 3.4.24.16

Chromosomal Location of Human Ortholog: 5q12.3

Cellular Component: mitochondrial intermembrane space

Molecular Function: metalloendopeptidase activity

Biological Process: peptide metabolic process

Research Articles on NLN

Similar Products

Product Notes

The NLN nln (Catalog #AAA1267762) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcgccc ggtgcctttt ggctgtgcga agcctccgca gagttggtgg ttccaggatt ttactcagaa tgacgttagg aagagaagtg atgtctcctc ttcaggcaat gtcttcctat actgtggctg gcagaaatgt tttaagatgg gatctttcac cagagcaaat taaaacaaga actgaggagc tcattgtgca gaccaaacag gtgtacgatg ctgttggaat gctcggtatt gaggaagtaa cttacgagaa ctgtctgcag gcactggcag atgtagaagt aaagtatata gtggaaagga ccatgctaga ctttccccag catgtatcct ctgacaaaga agtacgagca gcaagtacag aagcagacaa aagactttct cgttttgata ttgagatgag catgagagga gatatatttg agagaattgt tcatttacag gaaacctgtg atctggggaa gataaaacct gaggccagac gatacttgga aaagtcaatt aaaatgggga aaagaaatgg gctccatctt cctgaacaag tacagaatga aatcaaatca atgaagaaaa gaatgagtga gctatgtatt gattttaaca aaaacctcaa tgaggatgat accttccttg tattttccaa ggctgaactt ggtgctcttc ctcatgattt cattgacagt ttagaaaaga cagatgatga caagtataaa attaccttaa aatatccaca ctatttccct gtcatgaaga aatgttgtat ccctgaaacc agaagaagga tggaaatggc ttttaataca aggtgcaaag aggaaaacac cataattttg cagcagctac tcccactgcg aaccaaggtg gccaaactac tcggttatag cacacatgct gacttcgtcc ttgaaatgaa cactgcaaag agcacaagcc gcgtaacagc ctttctagat gatttaagcc agaagttaaa acccttgggt gaagcagaac gagagtttat tttgaatttg aagaaaaagg aatgcaaaga caggggtttt gaatatgatg ggaaaatcaa tgcctgggat ctatattact acatgactca gacagaggaa ctcaagtatt ccatagacca agagttcctc aaggaatact tcccaattga ggtggtcact gaaggcttgc tgaacaccta ccaggagttg ttgggacttt catttgaaca aatgacagat gctcatgttt ggaacaagag tgttacactt tatactgtga aggataaagc tacaggagaa gtattgggac agttctattt ggacctctat ccaagggaag gaaaatacaa tcatgcggcc tgcttcggtc tccagcctgg ctgccttctg cctgatggaa gccggatgat ggcagtggct gccctcgtgg tgaacttctc acagccagtg gcaggtcgtc cctctctcct gagacacgac gaggtgagga cttactttca tgagtttggt cacgtgatgc atcagatttg tgcacaggtg agtttttttt ttcccccagt aaacctgcca attagttttt ttagaaaact tcttgactgc tgtcaggttt ctgctcctaa caggtttttt cagaagctga atgtgttcaa gaattttata ggccttctgc aaaaccaaaa ttttccttat cctgtcctct ttcacaacat atttttactt ggaggttcat ctaccagtga aagatgtttg ttgaataaca gcctatggaa aaagaataag actatctgta aggaaaggtt acaaatactt tgctttttcc ttttaatcct ttag. It is sometimes possible for the material contained within the vial of "NLN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.