Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OVOL1 cdna clone

OVOL1 cDNA Clone

Gene Names
OVOL1; HOVO1
Synonyms
OVOL1; OVOL1 cDNA Clone; OVOL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccccgcgcgttcctggtgaagaagccgtgcgtctccacgtgcaagaggaactggagcgagctccccgacgaggagcgcggcgagatctacgtgccagtcagcctgggcttctgcccaccacagccctaccgggagccggaaccctctgtggccgaacccccttcctgcccgctggctttgaacatgagccttcgagactctagctacagcatggcccccgggccctgtgtggtggcccagctgccctctgaagacatgggccacttgacagacccccagagcagagaccatggcttcctgcgcaccaagatgaaggtgacccttggggacagtcccagtggagacctgttcacctgccgtgtctgccagaaggccttcacctaccagcgcatgctgaaccgccacatgaagtgtcacaacgacgtcaagaggcacctctgcacgtactgcgggaagggcttcaatgacaccttcgacctcaagagacacgtccgaactcacactggcgtgcggccctacaagtgcagcctgtgtgacaaggccttcacgcagcgctgctctctggagtctcacctcaagaagatccatggtgtgcagcagaagtacgcgtacaaggagcggcgggccaagctgtacgtgtgtgaggagtgcggctgcacatctgagagccaggagggccacgtcctgcacctgaaggagcaccaccctgacagcccgctgctgcgcaagacctccaagaaggtggccgtggcactacagaacactgtcacttccctgctgcagggcagcccccacctgtga
Sequence Length
804
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,259 Da
NCBI Official Full Name
Homo sapiens ovo-like 1(Drosophila), mRNA
NCBI Official Synonym Full Names
ovo like transcriptional repressor 1
NCBI Official Symbol
OVOL1
NCBI Official Synonym Symbols
HOVO1
NCBI Protein Information
putative transcription factor Ovo-like 1
UniProt Protein Name
Putative transcription factor Ovo-like 1
UniProt Gene Name
OVOL1
UniProt Synonym Gene Names
hOvo1
UniProt Entry Name
OVOL1_HUMAN

NCBI Description

This gene encodes a putative zinc finger containing transcription factor that is highly similar to homologous protein in Drosophila and mouse. Based on known functions in these species, this protein is likely involved in hair formation and spermatogenesis in human as well. [provided by RefSeq, Aug 2011]

Uniprot Description

OVOL1: Putative transcription factor. Involved in hair formation and spermatogenesis. May function in the differentiation and/or maintenance of the urogenital system.

Protein type: C2H2-type zinc finger protein; DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: nucleus

Research Articles on OVOL1

Similar Products

Product Notes

The OVOL1 ovol1 (Catalog #AAA1267713) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccccgcg cgttcctggt gaagaagccg tgcgtctcca cgtgcaagag gaactggagc gagctccccg acgaggagcg cggcgagatc tacgtgccag tcagcctggg cttctgccca ccacagccct accgggagcc ggaaccctct gtggccgaac ccccttcctg cccgctggct ttgaacatga gccttcgaga ctctagctac agcatggccc ccgggccctg tgtggtggcc cagctgccct ctgaagacat gggccacttg acagaccccc agagcagaga ccatggcttc ctgcgcacca agatgaaggt gacccttggg gacagtccca gtggagacct gttcacctgc cgtgtctgcc agaaggcctt cacctaccag cgcatgctga accgccacat gaagtgtcac aacgacgtca agaggcacct ctgcacgtac tgcgggaagg gcttcaatga caccttcgac ctcaagagac acgtccgaac tcacactggc gtgcggccct acaagtgcag cctgtgtgac aaggccttca cgcagcgctg ctctctggag tctcacctca agaagatcca tggtgtgcag cagaagtacg cgtacaagga gcggcgggcc aagctgtacg tgtgtgagga gtgcggctgc acatctgaga gccaggaggg ccacgtcctg cacctgaagg agcaccaccc tgacagcccg ctgctgcgca agacctccaa gaaggtggcc gtggcactac agaacactgt cacttccctg ctgcagggca gcccccacct gtga. It is sometimes possible for the material contained within the vial of "OVOL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.