Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHMP6 cdna clone

CHMP6 cDNA Clone

Gene Names
CHMP6; VPS20
Synonyms
CHMP6; CHMP6 cDNA Clone; CHMP6 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtaacctgttcggccgcaagaagcagagccgcgtcacggagcaggacaaggccatcctgcaactgaagcagcagcgggacaagctgaggcagtaccagaagaggatcgcccagcagctggagcgcgagcgcgccctggcccggcagctgctgcgggacggcaggaaggaacgggccaagctgctgctcaagaagaagcgataccaggagcagctcctggacaggacggagaaccagatcagcagcctggaggccatggttcagagtattgagttcacccagatcgaaatgaaagtgatggaggggctgcagtttggaaatgagtgtctgaacaagatgcaccaggtgatgtccattgaagaggtggagaggatcctggacgagacgcaggaggccgtggagtaccagcggcaaatagacgagctcctggcaggaagcttcactcaggaggatgaagacgccatcctggaggagctgagcgcaatcactcaggaacaaatagagctgccagaggttccctccgagccccttcctgagaagatcccagaaaacgtccctgtcaaggccaggcccaggcaggcggagctggtggcagcttcgtaa
Sequence Length
606
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,485 Da
NCBI Official Full Name
Homo sapiens chromatin modifying protein 6, mRNA
NCBI Official Synonym Full Names
charged multivesicular body protein 6
NCBI Official Symbol
CHMP6
NCBI Official Synonym Symbols
VPS20
NCBI Protein Information
charged multivesicular body protein 6
UniProt Protein Name
Charged multivesicular body protein 6
UniProt Gene Name
CHMP6
UniProt Synonym Gene Names
VPS20; Vps20; hVps20
UniProt Entry Name
CHMP6_HUMAN

NCBI Description

This gene encodes a member of the chromatin-modifying protein/charged multivesicular body protein family. Proteins in this family are part of the ESCRT-III (endosomal sorting complex required for transport III) which degrades surface receptors, and in biosynthesis of endosomes. [provided by RefSeq, Mar 2012]

Uniprot Description

CHMP6: Probable core component of the endosomal sorting required for transport complex III (ESCRT-III) which is involved in multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs. MVBs contain intraluminal vesicles (ILVs) that are generated by invagination and scission from the limiting membrane of the endosome and mostly are delivered to lysosomes enabling degradation of membrane proteins, such as stimulated growth factor receptors, lysosomal enzymes and lipids. The MVB pathway appears to require the sequential function of ESCRT-O, -I,-II and -III complexes. ESCRT-III proteins mostly dissociate from the invaginating membrane before the ILV is released. The ESCRT machinery also functions in topologically equivalent membrane fission events, such as the terminal stages of cytokinesis and the budding of enveloped viruses (HIV-1 and other lentiviruses). ESCRT-III proteins are believed to mediate the necessary vesicle extrusion and/or membrane fission activities, possibly in conjunction with the AAA ATPase VPS4. In the ESCRT-III complex, it probably serves as an acceptor for the ESCRT-II complex on endosomal membranes. Belongs to the SNF7 family.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 17q25.3

Cellular Component: cytosol; endosome membrane; membrane

Molecular Function: protein binding; protein N-terminus binding

Biological Process: autophagy; cell separation during cytokinesis; endosome transport; mitotic metaphase plate congression; nuclear organization and biogenesis; viral infectious cycle

Research Articles on CHMP6

Similar Products

Product Notes

The CHMP6 chmp6 (Catalog #AAA1267645) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtaacc tgttcggccg caagaagcag agccgcgtca cggagcagga caaggccatc ctgcaactga agcagcagcg ggacaagctg aggcagtacc agaagaggat cgcccagcag ctggagcgcg agcgcgccct ggcccggcag ctgctgcggg acggcaggaa ggaacgggcc aagctgctgc tcaagaagaa gcgataccag gagcagctcc tggacaggac ggagaaccag atcagcagcc tggaggccat ggttcagagt attgagttca cccagatcga aatgaaagtg atggaggggc tgcagtttgg aaatgagtgt ctgaacaaga tgcaccaggt gatgtccatt gaagaggtgg agaggatcct ggacgagacg caggaggccg tggagtacca gcggcaaata gacgagctcc tggcaggaag cttcactcag gaggatgaag acgccatcct ggaggagctg agcgcaatca ctcaggaaca aatagagctg ccagaggttc cctccgagcc ccttcctgag aagatcccag aaaacgtccc tgtcaaggcc aggcccaggc aggcggagct ggtggcagct tcgtaa. It is sometimes possible for the material contained within the vial of "CHMP6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.