Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VWF cdna clone

VWF cDNA Clone

Gene Names
VWF; VWD; F8VWF
Synonyms
VWF; VWF cDNA Clone; VWF cdna clone
Ordering
For Research Use Only!
Sequence
atgggggcacaggatgaggaggaaggaatccaagacttggatggattattagttttcgataagattgtggaggtcaccttgttgaacctcccatggtacaatgaagagactgagggtcagagaggagaaatgactgctccaaagtctcctagagccaaaatcagagggaccctttgtgcagaaggaactcgcggcaggtcatccacggcccgatgcagccttttcggaagtgacttcgtcaacacctttgatgggagcatgtacagctttgcgggatactgcagttacctcctggcagggggctgccagaaacgctccttctcgattattggggacttccagaatggcaagagagtgagcctctccgtgtatcttggggaattttttgacatccatttgtttgtcaatggtaccgtgacacagggggaccaaagagtctccatgccctatgcctccaaagggctgtatctagaaactgaggctgggtactacaagctgtccggtgaggcctatggctttgtggccaggatcgatggcagcggcaactttcaagtcctgctgtcagacagatacttcaacaagacctgcgggctgtgtggcaactttaacatctttgctgaagatgactttatgacccaagaagggaccttgacctcggacccttatgactttgccaactcatgggctctgagcagtggagaacagtggtgtgaacgggcatctcctcccagcagctcatgcaacatctcctctggggaaatgcagaaggtgggtgtggactggcctgggtgcacctggatggtgtgtgatttctggatctaa
Sequence Length
822
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,745 Da
NCBI Official Full Name
Homo sapiens von Willebrand factor, mRNA
NCBI Official Synonym Full Names
von Willebrand factor
NCBI Official Symbol
VWF
NCBI Official Synonym Symbols
VWD; F8VWF
NCBI Protein Information
von Willebrand factor
UniProt Protein Name
von Willebrand factor
Protein Family
UniProt Gene Name
VWF
UniProt Synonym Gene Names
F8VWF; vWF
UniProt Entry Name
VWF_HUMAN

NCBI Description

This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]

Uniprot Description

VWF: Important in the maintenance of hemostasis, it promotes adhesion of platelets to the sites of vascular injury by forming a molecular bridge between sub-endothelial collagen matrix and platelet-surface receptor complex GPIb-IX-V. Also acts as a chaperone for coagulation factor VIII, delivering it to the site of injury, stabilizing its heterodimeric structure and protecting it from premature clearance from plasma. Defects in VWF are the cause of von Willebrand disease type 1 (VWD1). A common hemorrhagic disorder due to defects in von Willebrand factor protein and resulting in impaired platelet aggregation. Von Willebrand disease type 1 is characterized by partial quantitative deficiency of circulating von Willebrand factor, that is otherwise structurally and functionally normal. Clinical manifestations are mucocutaneous bleeding, such as epistaxis and menorrhagia, and prolonged bleeding after surgery or trauma. Defects in VWF are the cause of von Willebrand disease type 2 (VWD2). A hemorrhagic disorder due to defects in von Willebrand factor protein and resulting in impaired platelet aggregation. Von Willebrand disease type 2 is characterized by qualitative deficiency and functional anomalies of von Willebrand factor. It is divided in different subtypes including 2A, 2B, 2M and 2N (Normandy variant). The mutant VWF protein in types 2A, 2B and 2M are defective in their platelet- dependent function, whereas the mutant protein in type 2N is defective in its ability to bind factor VIII. Clinical manifestations are mucocutaneous bleeding, such as epistaxis and menorrhagia, and prolonged bleeding after surgery or trauma. Defects in VWF are the cause of von Willebrand disease type 3 (VWD3). A severe hemorrhagic disorder due to a total or near total absence of von Willebrand factor in the plasma and cellular compartments, also leading to a profound deficiency of plasmatic factor VIII. Bleeding usually starts in infancy and can include epistaxis, recurrent mucocutaneous bleeding, excessive bleeding after minor trauma, and hemarthroses.

Protein type: Secreted; Secreted, signal peptide; Cell adhesion; Motility/polarity/chemotaxis; Extracellular matrix

Chromosomal Location of Human Ortholog: 12p13.3

Cellular Component: endoplasmic reticulum; extracellular matrix; extracellular region

Molecular Function: chaperone binding; collagen binding; glycoprotein binding; identical protein binding; immunoglobulin binding; integrin binding; protease binding; protein binding; protein homodimerization activity; protein N-terminus binding

Biological Process: blood coagulation; blood coagulation, intrinsic pathway; cell adhesion; cell-substrate adhesion; extracellular matrix organization and biogenesis; hemostasis; platelet activation; platelet degranulation; protein homooligomerization; response to wounding

Disease: Von Willebrand Disease, Type 1; Von Willebrand Disease, Type 2; Von Willebrand Disease, Type 3

Research Articles on VWF

Similar Products

Product Notes

The VWF vwf (Catalog #AAA1267642) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggcac aggatgagga ggaaggaatc caagacttgg atggattatt agttttcgat aagattgtgg aggtcacctt gttgaacctc ccatggtaca atgaagagac tgagggtcag agaggagaaa tgactgctcc aaagtctcct agagccaaaa tcagagggac cctttgtgca gaaggaactc gcggcaggtc atccacggcc cgatgcagcc ttttcggaag tgacttcgtc aacacctttg atgggagcat gtacagcttt gcgggatact gcagttacct cctggcaggg ggctgccaga aacgctcctt ctcgattatt ggggacttcc agaatggcaa gagagtgagc ctctccgtgt atcttgggga attttttgac atccatttgt ttgtcaatgg taccgtgaca cagggggacc aaagagtctc catgccctat gcctccaaag ggctgtatct agaaactgag gctgggtact acaagctgtc cggtgaggcc tatggctttg tggccaggat cgatggcagc ggcaactttc aagtcctgct gtcagacaga tacttcaaca agacctgcgg gctgtgtggc aactttaaca tctttgctga agatgacttt atgacccaag aagggacctt gacctcggac ccttatgact ttgccaactc atgggctctg agcagtggag aacagtggtg tgaacgggca tctcctccca gcagctcatg caacatctcc tctggggaaa tgcagaaggt gggtgtggac tggcctgggt gcacctggat ggtgtgtgat ttctggatct aa. It is sometimes possible for the material contained within the vial of "VWF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.