Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CPB2 cdna clone

CPB2 cDNA Clone

Gene Names
CPB2; CPU; PCPB; TAFI
Synonyms
CPB2; CPB2 cDNA Clone; CPB2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagctttgcagccttgcagtccttgtacccattgttctcttctgtgagcagcatgtcttcgcgtttcagagtggccaagttctagctgctcttcctagaacctctaggcaagttcaagttctacagaatcttactacaacatatgagattgttctctggcagccggtaacagctgaccttattgtgaagaaaaaacaagtccatttttttgtaaatgcatctgatgtcgacaatgtgaaagcccatttaaatgtgagcggaattccatgcagtgtcttgctggcagacgtggaagatcttattcaacagcagatttccaacgacacagtcagcccccgagcctccgcatcgtactatgaacagtatcactcactaaatgaaatctattcttggatagaatttataactgagaggcatcctgatatgcttacaaaaatccacattggatcctcatttgagaagtacccactctatgttttaaaggtttctggaaaagaacaagcagccaaaaatgccatatggattgactgtggaatccatgccagagaatggatctctcctgctttctgcttgtggttcataggccatataactcaattctatgggataatagggcaatataccaatctcctgaggcttgtggatttctatgttatgccggtggttaatgtggatggttatgactactcatggaaaaagaatcgaatgtggagaaagaaccgttctttctatgcgaacaatcattgcatcggaacagacctgaataggaactttgcttccaaacactggtgtgaggaaggtgcatccagttcctcatgctcggaaacctactgtggactttatcctgagtcagaaccagaagtgaaggcagtggctagtttcttgagaagaaatatcaaccagattaaagcatacatcagcatgcattcatactcccagcatatagtgtttccatattcctatacacgaagtaaaagcaaagaccatgaggaactgtctctagtagccagtgaagcagttcgtgctattgagaaaactagtaaaaataccaggtatacacatggccatggctcagaaaccttatacctagctcctggaggtggggacgattggatctatgatttgggcatcaaatattcgtttacaattgaacttcgagatacgggcacatacggattcttgctgccggagcgttacatcaaacccacctgtagagaagcttttgccgctgtctctaaaatagcttggcatgtcattaggaatgtttaa
Sequence Length
1272
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,922 Da
NCBI Official Full Name
Homo sapiens carboxypeptidase B2 (plasma), mRNA
NCBI Official Synonym Full Names
carboxypeptidase B2
NCBI Official Symbol
CPB2
NCBI Official Synonym Symbols
CPU; PCPB; TAFI
NCBI Protein Information
carboxypeptidase B2
UniProt Protein Name
Carboxypeptidase B2
Protein Family
UniProt Gene Name
CPB2
UniProt Synonym Gene Names
CPU; pCPB; TAFI
UniProt Entry Name
CBPB2_HUMAN

NCBI Description

Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). The protein encoded by this gene is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Polymorphisms have been described for this gene and its promoter region. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]

Uniprot Description

CPB2: Cleaves C-terminal arginine or lysine residues from biologically active peptides such as kinins or anaphylatoxins in the circulation thereby regulating their activities. Down- regulates fibrinolysis by removing C-terminal lysine residues from fibrin that has already been partially degraded by plasmin. Belongs to the peptidase M14 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Protease; EC 3.4.17.20; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 13q14.11

Biological Process: fibrinolysis

Research Articles on CPB2

Similar Products

Product Notes

The CPB2 cpb2 (Catalog #AAA1267606) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcttt gcagccttgc agtccttgta cccattgttc tcttctgtga gcagcatgtc ttcgcgtttc agagtggcca agttctagct gctcttccta gaacctctag gcaagttcaa gttctacaga atcttactac aacatatgag attgttctct ggcagccggt aacagctgac cttattgtga agaaaaaaca agtccatttt tttgtaaatg catctgatgt cgacaatgtg aaagcccatt taaatgtgag cggaattcca tgcagtgtct tgctggcaga cgtggaagat cttattcaac agcagatttc caacgacaca gtcagccccc gagcctccgc atcgtactat gaacagtatc actcactaaa tgaaatctat tcttggatag aatttataac tgagaggcat cctgatatgc ttacaaaaat ccacattgga tcctcatttg agaagtaccc actctatgtt ttaaaggttt ctggaaaaga acaagcagcc aaaaatgcca tatggattga ctgtggaatc catgccagag aatggatctc tcctgctttc tgcttgtggt tcataggcca tataactcaa ttctatggga taatagggca atataccaat ctcctgaggc ttgtggattt ctatgttatg ccggtggtta atgtggatgg ttatgactac tcatggaaaa agaatcgaat gtggagaaag aaccgttctt tctatgcgaa caatcattgc atcggaacag acctgaatag gaactttgct tccaaacact ggtgtgagga aggtgcatcc agttcctcat gctcggaaac ctactgtgga ctttatcctg agtcagaacc agaagtgaag gcagtggcta gtttcttgag aagaaatatc aaccagatta aagcatacat cagcatgcat tcatactccc agcatatagt gtttccatat tcctatacac gaagtaaaag caaagaccat gaggaactgt ctctagtagc cagtgaagca gttcgtgcta ttgagaaaac tagtaaaaat accaggtata cacatggcca tggctcagaa accttatacc tagctcctgg aggtggggac gattggatct atgatttggg catcaaatat tcgtttacaa ttgaacttcg agatacgggc acatacggat tcttgctgcc ggagcgttac atcaaaccca cctgtagaga agcttttgcc gctgtctcta aaatagcttg gcatgtcatt aggaatgttt aa. It is sometimes possible for the material contained within the vial of "CPB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.