Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MCAM cdna clone

MCAM cDNA Clone

Gene Names
MCAM; CD146; MUC18
Synonyms
MCAM; MCAM cDNA Clone; MCAM cdna clone
Ordering
For Research Use Only!
Sequence
atggggcttcccaggctggtctgcgccttcttgctcgccgcctgctgctgctgtcctcgcgtcgcgggtgtgcccggagaggctgagcagcctgcgcctgagctggtggaggtggaagtgggcagcacagcccttctgaagtgcggcctctcccagtcccaaggcaacctcagccatgtcgactggttttctgtccacaaggagaagcggacgctcatcttccgtgtgcgccagggccagggccagagcgaacctggggagtacgagcagcggctcagcctccaggacagaggggctactctggccctgactcaagtcaccccccaagacgagcgcatcttcttgtgccagggcaagcgccctcggtcccaggagtaccgcatccagctccgcgtctacaaagctccggaggagccaaacatccaggtcaaccccctgggcatccctgtgaacagtaaggagcctgaggaggtcgctacctgtgtagggaggaacgggtaccccattcctcaagtcatctggtacaagaatggccggcctctgaaggaggagaagaaccgggtccacattcagtcgtcccagactgtggagtcgagtggtttgtacaccttgcagagtattctgaaggcacagctggttaaagaagacaaagatgcccagttttactgtgagctcaactaccggctgcccagtgggaaccacatgaaggagtccagggaagtcaccgtccctgttttctacccgacagaaaaagtgtggctggaagtggagcccgtgggaatgctgaaggaaggggaccgcgtggaaatcaggtgtttggctgatggcaaccctccaccacacttcagcatcagcaagcagaaccccagcaccagggaggcagaggaagagacaaccaacgacaacggggtcctggtgctggagcctgcccggaaggaacacagtgggcgctatgaatgtcagggcctggacttggacaccatgatatcgctgctgagtgaaccacaggaactactggtgaactatgtgtctgacgtccgagtgagtcccgcagcccctgagagacaggaaggcagcagcctcaccctgacctgtgaggcagagagtagccaggacctcgagttccagtggctgagagaagagacaggccaggtgctggaaagggggcctgtgcttcagttgcatgacctgaaacgggaggcaggaggcggctatcgctgcgtggcgtctgtgcccagcatacccggcctgaaccgcacacagctggtcaacgtggccatttttggccccccttggatggcattcaaggagaggaaggtgtgggtgaaagagaatatggtgttgaatctgtcttgtgaagcgtcagggcacccccggcccaccatctcctggaacgtcaacggcacggcaagtgaacaagaccaagatccacagcgagtcctgagcaccctgaatgtcctcgtgaccccggagctgttggagacaggtgttgaatgcacggcctccaacgacctgggcaaaaacaccagcatcctcttcctggagctggtcaatttaaccaccctcacaccagactccaacacaaccactggcctcagcacttccactgccagtcctcataccagagccaacagcacctccacagagagaaagctgccggagccggagagccggggcgtggtcatcgtggctgtgattgtgtgcatcctggtcctggcggtgctgggcgctgtcctctatttcctctataagaagggcaagctgccgtgcaggcgctcagggaagcaggagatcacgctgcccccgtctcgtaagagcgaacttgtagttgaagttaagtcagataagctcccagaagagatgggcctcctgcagggcagcagcggtgacaagagggctccgggagaccagggagagaaatacatcgatctgaggcattag
Sequence Length
1941
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,605 Da
NCBI Official Full Name
Homo sapiens melanoma cell adhesion molecule, mRNA
NCBI Official Synonym Full Names
melanoma cell adhesion molecule
NCBI Official Symbol
MCAM
NCBI Official Synonym Symbols
CD146; MUC18
NCBI Protein Information
cell surface glycoprotein MUC18
UniProt Protein Name
Cell surface glycoprotein MUC18
Protein Family
UniProt Gene Name
MCAM
UniProt Synonym Gene Names
MUC18
UniProt Entry Name
MUC18_HUMAN

Uniprot Description

MCAM: Plays a role in cell adhesion, and in cohesion of the endothelial monolayer at intercellular junctions in vascular tissue. Its expression may allow melanoma cells to interact with cellular elements of the vascular system, thereby enhancing hematogeneous tumor spread. Could be an adhesion molecule active in neural crest cells during embryonic development. Acts as surface receptor that triggers tyrosine phosphorylation of FYN and PTK2/FAK1, and a transient increase in the intracellular calcium concentration. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Cell adhesion

Chromosomal Location of Human Ortholog: 11q23.3

Cellular Component: external side of plasma membrane; focal adhesion

Biological Process: anatomical structure morphogenesis; angiogenesis; glomerular filtration

Research Articles on MCAM

Similar Products

Product Notes

The MCAM mcam (Catalog #AAA1267412) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggcttc ccaggctggt ctgcgccttc ttgctcgccg cctgctgctg ctgtcctcgc gtcgcgggtg tgcccggaga ggctgagcag cctgcgcctg agctggtgga ggtggaagtg ggcagcacag cccttctgaa gtgcggcctc tcccagtccc aaggcaacct cagccatgtc gactggtttt ctgtccacaa ggagaagcgg acgctcatct tccgtgtgcg ccagggccag ggccagagcg aacctgggga gtacgagcag cggctcagcc tccaggacag aggggctact ctggccctga ctcaagtcac cccccaagac gagcgcatct tcttgtgcca gggcaagcgc cctcggtccc aggagtaccg catccagctc cgcgtctaca aagctccgga ggagccaaac atccaggtca accccctggg catccctgtg aacagtaagg agcctgagga ggtcgctacc tgtgtaggga ggaacgggta ccccattcct caagtcatct ggtacaagaa tggccggcct ctgaaggagg agaagaaccg ggtccacatt cagtcgtccc agactgtgga gtcgagtggt ttgtacacct tgcagagtat tctgaaggca cagctggtta aagaagacaa agatgcccag ttttactgtg agctcaacta ccggctgccc agtgggaacc acatgaagga gtccagggaa gtcaccgtcc ctgttttcta cccgacagaa aaagtgtggc tggaagtgga gcccgtggga atgctgaagg aaggggaccg cgtggaaatc aggtgtttgg ctgatggcaa ccctccacca cacttcagca tcagcaagca gaaccccagc accagggagg cagaggaaga gacaaccaac gacaacgggg tcctggtgct ggagcctgcc cggaaggaac acagtgggcg ctatgaatgt cagggcctgg acttggacac catgatatcg ctgctgagtg aaccacagga actactggtg aactatgtgt ctgacgtccg agtgagtccc gcagcccctg agagacagga aggcagcagc ctcaccctga cctgtgaggc agagagtagc caggacctcg agttccagtg gctgagagaa gagacaggcc aggtgctgga aagggggcct gtgcttcagt tgcatgacct gaaacgggag gcaggaggcg gctatcgctg cgtggcgtct gtgcccagca tacccggcct gaaccgcaca cagctggtca acgtggccat ttttggcccc ccttggatgg cattcaagga gaggaaggtg tgggtgaaag agaatatggt gttgaatctg tcttgtgaag cgtcagggca cccccggccc accatctcct ggaacgtcaa cggcacggca agtgaacaag accaagatcc acagcgagtc ctgagcaccc tgaatgtcct cgtgaccccg gagctgttgg agacaggtgt tgaatgcacg gcctccaacg acctgggcaa aaacaccagc atcctcttcc tggagctggt caatttaacc accctcacac cagactccaa cacaaccact ggcctcagca cttccactgc cagtcctcat accagagcca acagcacctc cacagagaga aagctgccgg agccggagag ccggggcgtg gtcatcgtgg ctgtgattgt gtgcatcctg gtcctggcgg tgctgggcgc tgtcctctat ttcctctata agaagggcaa gctgccgtgc aggcgctcag ggaagcagga gatcacgctg cccccgtctc gtaagagcga acttgtagtt gaagttaagt cagataagct cccagaagag atgggcctcc tgcagggcag cagcggtgac aagagggctc cgggagacca gggagagaaa tacatcgatc tgaggcatta g. It is sometimes possible for the material contained within the vial of "MCAM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.