PACSIN3 cdna clone

PACSIN3 cDNA Clone

Gene Names

PACSIN3; SDPIII

Synonyms

PACSIN3; PACSIN3 cDNA Clone; PACSIN3 cdna clone

Ordering
Cat. Num. AAA1267361 For Research Use Only!

Sequence

atggctccagaagaggacgctggaggggaggccttagggggcagtttctgggaggctggcaactacaggcgcacggtacagcgggtggaggacgggcaccggctgtgcggggacctggtcagctgcttccaggagcgcgcccgcatcgagaaggcttatgcccagcagttggctgactgggcccgaaagtggagggggaccgtggagaagggcccccagtatggcacactggagaaggcctggcatgcctttttcacggcggctgagcggctgagcgcgctgcacctggaggtgcgggagaagctgcaagggcaggacagtgagcgggtgcgcgcctggcagcggggggctttccaccggcctgtgctgggcggcttccgcgagagccgggcggccgaggacggcttccgcaaggcccagaagccctggctgaagaggctgaaggaggttgaggcttccaagaaaagctaccacgcagcccggaaggatgagaagaccgcccagacgagggagagccacgcaaaggcagacagcgccgtctcccaggagcagctgcgcaaactgcaggaacgggtggaacgctgtgccaaggaggccgagaagacaaaagctcagtatgagcagacgctggcagagctgcatcgctacactccacgctacatggaggacatggaacaggcctttgagacctgccaggccgccgagcgccagcggcttcttttcttcaaggatatgctgctcaccttacaccagcacctggacctttccagcagtgagaagttccatgaactccaccgtgacttgcaccagggcattgaggcagccagtgacgaagaggatctgcgctggtggcgcagcacccacgggccaggcatggccatgaactggccacagttcgaggagtggtccttggacacacagaggacaatcagccggaaagagaagggtggccggagccctgatgaggttaccctgaccagcattgtgcctacaagagatggcaccgcacccccaccccagtccccggggtccccaggcacggggcaggatgaggagtggtcagatgaagagagtccccggaaggctgccaccggggttcgggtgagggcactctatgactacgctggccaggaagctgatgagctgagcttccgagcaggggaggagctgctgaagatgagtgaggaggacgagcagggctggtgccaaggccagttgcagagtggccgcattggcctgtaccctgccaactacgtggagtgtgtgggcgcctga

Sequence Length

1275

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

33873769

NCBI GeneID

29763

Molecular Weight

48,487 Da

NCBI Official Full Name

Homo sapiens protein kinase C and casein kinase substrate in neurons 3, mRNA

NCBI Official Synonym Full Names

protein kinase C and casein kinase substrate in neurons 3

NCBI Official Symbol

PACSIN3

NCBI Official Synonym Symbols

SDPIII

NCBI Protein Information

protein kinase C and casein kinase substrate in neurons protein 3

UniProt Protein Name

Protein kinase C and casein kinase substrate in neurons protein 3

Protein Family

Protein kinase C and casein kinase II substrate protein

UniProt Gene Name

PACSIN3

UniProt Entry Name

PACN3_HUMAN

NCBI Description

This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]

Uniprot Description

PACSIN3: May play a role in vesicle formation and transport. Belongs to the PACSIN family.

Protein type: Vesicle; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 11p12-p11.12

Cellular Component: cytoplasm; endosome; nucleoplasm; plasma membrane

Molecular Function: calcium channel inhibitor activity; cytoskeletal protein binding; lipid binding; protein binding

Biological Process: negative regulation of calcium ion transport; negative regulation of endocytosis; positive regulation of membrane protein ectodomain proteolysis; regulation of endocytosis

Research Articles on PACSIN3

1. Show that in neuroendocrine chromaffin cells fusion pore expansion and catecholamine release are limited specifically by mutation of syndapin 3.

Similar Products

Product Notes

The PACSIN3 pacsin3 (Catalog #AAA1267361) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctccag aagaggacgc tggaggggag gccttagggg gcagtttctg ggaggctggc aactacaggc gcacggtaca gcgggtggag gacgggcacc ggctgtgcgg ggacctggtc agctgcttcc aggagcgcgc ccgcatcgag aaggcttatg cccagcagtt ggctgactgg gcccgaaagt ggagggggac cgtggagaag ggcccccagt atggcacact ggagaaggcc tggcatgcct ttttcacggc ggctgagcgg ctgagcgcgc tgcacctgga ggtgcgggag aagctgcaag ggcaggacag tgagcgggtg cgcgcctggc agcggggggc tttccaccgg cctgtgctgg gcggcttccg cgagagccgg gcggccgagg acggcttccg caaggcccag aagccctggc tgaagaggct gaaggaggtt gaggcttcca agaaaagcta ccacgcagcc cggaaggatg agaagaccgc ccagacgagg gagagccacg caaaggcaga cagcgccgtc tcccaggagc agctgcgcaa actgcaggaa cgggtggaac gctgtgccaa ggaggccgag aagacaaaag ctcagtatga gcagacgctg gcagagctgc atcgctacac tccacgctac atggaggaca tggaacaggc ctttgagacc tgccaggccg ccgagcgcca gcggcttctt ttcttcaagg atatgctgct caccttacac cagcacctgg acctttccag cagtgagaag ttccatgaac tccaccgtga cttgcaccag ggcattgagg cagccagtga cgaagaggat ctgcgctggt ggcgcagcac ccacgggcca ggcatggcca tgaactggcc acagttcgag gagtggtcct tggacacaca gaggacaatc agccggaaag agaagggtgg ccggagccct gatgaggtta ccctgaccag cattgtgcct acaagagatg gcaccgcacc cccaccccag tccccggggt ccccaggcac ggggcaggat gaggagtggt cagatgaaga gagtccccgg aaggctgcca ccggggttcg ggtgagggca ctctatgact acgctggcca ggaagctgat gagctgagct tccgagcagg ggaggagctg ctgaagatga gtgaggagga cgagcagggc tggtgccaag gccagttgca gagtggccgc attggcctgt accctgccaa ctacgtggag tgtgtgggcg cctga. It is sometimes possible for the material contained within the vial of "PACSIN3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

PACSIN3 cdna clone