Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LCE3C cdna clone

LCE3C cDNA Clone

Gene Names
LCE3C; LEP15; SPRL3A
Synonyms
LCE3C; LCE3C cDNA Clone; LCE3C cdna clone
Ordering
For Research Use Only!
Sequence
atgtcctgccagcaaaaccagcagcagtgccagccccctcccagttgtccctcacccaagtgtcccccaaagagcccagcacagtgtctgcctccaccctcttctgactgtgctctaagctccgggggctgtggccccagttctgaaagtggctgctgcctgagccaccacaggcacttcaggtcccatcaatgccggcgccagagatccaactcctgtgacaggggcagtggtcagcaaggcgggggctcctgccgtggccatggctctgggggctgctgctga
Sequence Length
285
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,729 Da
NCBI Official Full Name
Homo sapiens late cornified envelope 3C, mRNA
NCBI Official Synonym Full Names
late cornified envelope 3C
NCBI Official Symbol
LCE3C
NCBI Official Synonym Symbols
LEP15; SPRL3A
NCBI Protein Information
late cornified envelope protein 3C
UniProt Protein Name
Late cornified envelope protein 3C
UniProt Gene Name
LCE3C
UniProt Synonym Gene Names
LEP15; SPRL3A
UniProt Entry Name
LCE3C_HUMAN

Uniprot Description

LCE3C: Precursors of the cornified envelope of the stratum corneum. Belongs to the LCE family

Chromosomal Location of Human Ortholog: 1q21.3

Cellular Component: cornified envelope; cytoplasm

Molecular Function: protein binding; structural molecule activity

Biological Process: keratinocyte differentiation; peptide cross-linking

Research Articles on LCE3C

Similar Products

Product Notes

The LCE3C lce3c (Catalog #AAA1267358) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcctgcc agcaaaacca gcagcagtgc cagccccctc ccagttgtcc ctcacccaag tgtcccccaa agagcccagc acagtgtctg cctccaccct cttctgactg tgctctaagc tccgggggct gtggccccag ttctgaaagt ggctgctgcc tgagccacca caggcacttc aggtcccatc aatgccggcg ccagagatcc aactcctgtg acaggggcag tggtcagcaa ggcgggggct cctgccgtgg ccatggctct gggggctgct gctga. It is sometimes possible for the material contained within the vial of "LCE3C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.