Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LAX1 cdna clone

LAX1 cDNA Clone

Gene Names
LAX1; LAX
Synonyms
LAX1; LAX1 cDNA Clone; LAX1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccttgctgactttgccacaaaccagacaaagagccaaaaatatttatgacatcttgccttggcgacaggaagacctggggagacatgagtcgaggagtatgcgcattttcagtactgagagcctcctctccagaaattctgagagcccggagcatgtgccctcccaagcaggcaatgccttccaggagcatacagcccacatccatgccacagagtacgcggtgggtatctatgacaacgccatggtcccccagatgtgtgggaacctcactccctcggcacactgcatcaatgtcagagcttccagagactgcgcaagcatttcttcagaggattcgcatgattatgtcaatgtccccacagcagaagagattgctgagactctagcttctaccaaaagcccttccagaaatctctttgttcttcccagtacccagaagctggagtttactgaggaaagagatgagggctgtggagatgctggtgactgcaccagtttgtattctccaggagctgaggacagtgattcactcagcaatggagaaggttcttctcagatctcaaatgactatgtcaacatgacagggttggatctcagtgccatccaggaaaggcagctctgggtggcttttcagtgctgcagagactatgaaaatgttccagcagcagatcccagtggaagccagcagcaggctgagaaagatgtgccatcctcaaacataggtcatgtcgaggacaagacagatgatcccgggacccatgtccaatgtgtcaaaaggacattccttgcttcaggggattatgcagactttcagccattcacacagagtgaggacagtcagatgaaacatagagaagagatgtcaaatgaggactccagtgactatgaaaatgtgctaactgccaagttaggaggcagggactctgagcaggggcctggcactcagctccttcctgatgaatga
Sequence Length
969
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,491 Da
NCBI Official Full Name
Homo sapiens lymphocyte transmembrane adaptor 1, mRNA
NCBI Official Synonym Full Names
lymphocyte transmembrane adaptor 1
NCBI Official Symbol
LAX1
NCBI Official Synonym Symbols
LAX
NCBI Protein Information
lymphocyte transmembrane adapter 1
UniProt Protein Name
Lymphocyte transmembrane adapter 1
UniProt Gene Name
LAX1
UniProt Synonym Gene Names
LAX
UniProt Entry Name
LAX1_HUMAN

Uniprot Description

LAX1: Negatively regulates TCR (T-cell antigen receptor)- mediated signaling in T-cells and BCR (B-cell antigen receptor)- mediated signaling in B-cells. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q32.1

Cellular Component: cytoplasm; Golgi apparatus; integral to membrane; lipid raft; membrane; plasma membrane

Molecular Function: protein binding; protein kinase binding; SH2 domain binding

Biological Process: B cell activation; immune response; inactivation of MAPK activity; negative regulation of T cell activation

Research Articles on LAX1

Similar Products

Product Notes

The LAX1 lax1 (Catalog #AAA1267283) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccttgc tgactttgcc acaaaccaga caaagagcca aaaatattta tgacatcttg ccttggcgac aggaagacct ggggagacat gagtcgagga gtatgcgcat tttcagtact gagagcctcc tctccagaaa ttctgagagc ccggagcatg tgccctccca agcaggcaat gccttccagg agcatacagc ccacatccat gccacagagt acgcggtggg tatctatgac aacgccatgg tcccccagat gtgtgggaac ctcactccct cggcacactg catcaatgtc agagcttcca gagactgcgc aagcatttct tcagaggatt cgcatgatta tgtcaatgtc cccacagcag aagagattgc tgagactcta gcttctacca aaagcccttc cagaaatctc tttgttcttc ccagtaccca gaagctggag tttactgagg aaagagatga gggctgtgga gatgctggtg actgcaccag tttgtattct ccaggagctg aggacagtga ttcactcagc aatggagaag gttcttctca gatctcaaat gactatgtca acatgacagg gttggatctc agtgccatcc aggaaaggca gctctgggtg gcttttcagt gctgcagaga ctatgaaaat gttccagcag cagatcccag tggaagccag cagcaggctg agaaagatgt gccatcctca aacataggtc atgtcgagga caagacagat gatcccggga cccatgtcca atgtgtcaaa aggacattcc ttgcttcagg ggattatgca gactttcagc cattcacaca gagtgaggac agtcagatga aacatagaga agagatgtca aatgaggact ccagtgacta tgaaaatgtg ctaactgcca agttaggagg cagggactct gagcaggggc ctggcactca gctccttcct gatgaatga. It is sometimes possible for the material contained within the vial of "LAX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.