Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NDFIP2 cdna clone

NDFIP2 cDNA Clone

Gene Names
NDFIP2; N4WBP5A
Synonyms
NDFIP2; NDFIP2 cDNA Clone; NDFIP2 cdna clone
Ordering
For Research Use Only!
Sequence
atggatcaccaccagccggggactgggcgctaccaggtgcttcttaatgaagaggataactcagaatcatcggctatagagcagccacctacttcaaacccagcaccgcagattgtgcaggctgcgtcttcagcaccagcacttgaaactgactcttcccctccaccatatagtagtattactgtggaagtacctacaacttcagatacagaagtttacggtgagttttatcccgtgccacctccctatagcgttgctacctctcttcctacatacgatgaagctgagaaggctaaagctgctgcaatggcagctgcagcagcagaaacatctcaaagaattcaggaggaagagtgtccaccaagagatgacttcagtgatgcagaccagctcagagtggggaatgatggcattttcatgctggcatttttcatggcatttattttcaactggcttggattttgtttatccttctgtatcaccaataccatagctggaaggtatggtgctatctgcggatttggcctttccttgatcaaatggatccttattgtcaggttttctgattattttactggatatttcaatggacagtattggctttggtggatatttcttgtacttggcctgctccttttcttcagaggatttgttaattatctaaaagtcagaaacatgtctgaaagtatggcagctgctcatagaacaaggtatttcttcttattgtag
Sequence Length
729
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,390 Da
NCBI Official Full Name
Homo sapiens Nedd4 family interacting protein 2, mRNA
NCBI Official Synonym Full Names
Nedd4 family interacting protein 2
NCBI Official Symbol
NDFIP2
NCBI Official Synonym Symbols
N4WBP5A
NCBI Protein Information
NEDD4 family-interacting protein 2
UniProt Protein Name
NEDD4 family-interacting protein 2
UniProt Gene Name
NDFIP2
UniProt Synonym Gene Names
KIAA1165; N4WBP5A
UniProt Entry Name
NFIP2_HUMAN

Uniprot Description

NDFIP2: Activates HECT domain-containing E3 ubiquitin-protein ligases, including ITCH, NEDD4, NEDD4L, SMURF2, WWP1 and WWP2, and consequently modulates the stability of their targets. As a result, may control many cellular processes. Recruits ITCH, NEDD4 and SMURF2 to endosomal membranes. May modulate EGFR signaling.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 13q31.1

Cellular Component: cytoplasm; endoplasmic reticulum; Golgi apparatus; intracellular membrane-bound organelle; mitochondrion; perinuclear region of cytoplasm

Molecular Function: protein binding; signal transducer activity; WW domain binding

Biological Process: negative regulation of protein transport; negative regulation of transporter activity; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of protein ubiquitination

Research Articles on NDFIP2

Similar Products

Product Notes

The NDFIP2 ndfip2 (Catalog #AAA1267280) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatcacc accagccggg gactgggcgc taccaggtgc ttcttaatga agaggataac tcagaatcat cggctataga gcagccacct acttcaaacc cagcaccgca gattgtgcag gctgcgtctt cagcaccagc acttgaaact gactcttccc ctccaccata tagtagtatt actgtggaag tacctacaac ttcagataca gaagtttacg gtgagtttta tcccgtgcca cctccctata gcgttgctac ctctcttcct acatacgatg aagctgagaa ggctaaagct gctgcaatgg cagctgcagc agcagaaaca tctcaaagaa ttcaggagga agagtgtcca ccaagagatg acttcagtga tgcagaccag ctcagagtgg ggaatgatgg cattttcatg ctggcatttt tcatggcatt tattttcaac tggcttggat tttgtttatc cttctgtatc accaatacca tagctggaag gtatggtgct atctgcggat ttggcctttc cttgatcaaa tggatcctta ttgtcaggtt ttctgattat tttactggat atttcaatgg acagtattgg ctttggtgga tatttcttgt acttggcctg ctccttttct tcagaggatt tgttaattat ctaaaagtca gaaacatgtc tgaaagtatg gcagctgctc atagaacaag gtatttcttc ttattgtag. It is sometimes possible for the material contained within the vial of "NDFIP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.