Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRKAA1 cdna clone

PRKAA1 cDNA Clone

Gene Names
PRKAA1; AMPK; AMPKa1
Synonyms
PRKAA1; PRKAA1 cDNA Clone; PRKAA1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgacagccgagaagcagaaacacgacgggcgggtgaagatcggccactacattctgggtgacacgctgggggtcggcaccttcggcaaagtgaaggttggcaaacatgaattgactgggcataaagtagctgtgaagatactcaatcgacagaagattcggagccttgatgtggtaggaaaaatccgcagagaaattcagaacctcaagcttttcaggcatcctcatataattaaactgtaccaggtcatcagtacaccatctgatattttcatggtgatggaatatgtctcaggaggagagctatttgattatatctgtaagaatggaaggctggatgaaaaagaaagtcggcgtctgttccaacagatcctttctggtgtggattattgtcacaggcatatggtggtccatagagatttgaaacctgaaaatgtcctgcttgatgcacacatgaatgcaaagatagctgattttggtctttcaaacatgatgtcagatggtgaatttttaagaacaagttgtggctcacccaactatgctgcaccagaagtaatttcaggaagattgtatgcaggcccagaggtagatatatggagcagtggggttattctctatgctttattatgtggaacccttccatttgatgatgaccatgtgccaactctttttaagaagatatgtgatgggatcttctatacccctcaatatttaaatccttctgtgattagccttttgaaacatatgctgcaggtggatcccatgaagagggccacaatcaaagatatcagggaacatgaatggtttaaacaggaccttccaaaatatctctttcctgaggatccatcatatagttcaaccatgattgatgatgaagccttaaaagaagtatgtgaaaagtttgagtgctcagaagaggaagttctcagctgtctttacaacagaaatcaccaggatcctttggcagttgcctaccatctcataatagataacaggagaataatgaatgaagccaaagatttctatttggcgacaagcccacctgattcttttcttgatgatcatcacctgactcggccccatcctgaaagagtaccattcttggttgctgaaacaccaagggcacgccatacccttgatgaattaaatccacagaaatccaaacaccaaggtgtaaggaaagcaaaatggcatttaggaattagaagtcaaagtcgaccaaatgatattatggcagaagtatgtagagcaatcaaacaattggattatgaatggaaggttgtaaacccatattatttgcgtgtacgaaggaagaatcctgtgacaagcacttactccaaaatgagtctacagttataccaagtggatagtagaacttatctactggatttccgtagtattgatgatgaaattacagaagccaaatcagggactgctactccacagagatcgggatcagttagcaactatcgatcttgccaaaggagtgattcagatgctgaggctcaaggaaaatcctcagaagtttctcttacctcatctgtgacctcacttgactcttctcctgttgacctaactccaagacctggaagtcacacaatagaattttttgagatgtgtgcaaatctaattaaaattcttgcacaataa
Sequence Length
1653
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,523 Da
NCBI Official Full Name
Homo sapiens protein kinase, AMP-activated, alpha 1 catalytic subunit, mRNA
NCBI Official Synonym Full Names
protein kinase AMP-activated catalytic subunit alpha 1
NCBI Official Symbol
PRKAA1
NCBI Official Synonym Symbols
AMPK; AMPKa1
NCBI Protein Information
5'-AMP-activated protein kinase catalytic subunit alpha-1
UniProt Protein Name
5'-AMP-activated protein kinase catalytic subunit alpha-1
UniProt Gene Name
PRKAA1
UniProt Synonym Gene Names
AMPK1; HMGCR kinase
UniProt Entry Name
AAPK1_HUMAN

NCBI Description

The protein encoded by this gene belongs to the ser/thr protein kinase family. It is the catalytic subunit of the 5'-prime-AMP-activated protein kinase (AMPK). AMPK is a cellular energy sensor conserved in all eukaryotic cells. The kinase activity of AMPK is activated by the stimuli that increase the cellular AMP/ATP ratio. AMPK regulates the activities of a number of key metabolic enzymes through phosphorylation. It protects cells from stresses that cause ATP depletion by switching off ATP-consuming biosynthetic pathways. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]

Uniprot Description

AMPKA1: a catalytic subunit of AMP-activated protein kinase (AMPK). Acts as an energy sensor, playing a key role in regulating cellular energy metabolism. A protein kinase of the CAMKL family whose activation is regulated by the balance between ADP/AMP/ATP, and intracellular Ca(2+) levels. Acts as a metabolic stress-sensing protein kinase switching off biosynthetic pathways when cellular ATP levels are depleted and when 5'-ADP and -AMP rise in response to fuel limitation and/or hypoxia. Activates energy-producing pathways and inhibits energy-consuming processes. Restores ATP levels in cells by switching off anabolic and switching on catabolic pathways. Activated primarily by rising ADP levels and not, as previously thought, solely by AMP. AMPK resembles an adenylate charge regulatory system in which anabolic and catabolic pathways are regulated by adenine nucleotide ratios. Acts via direct phosphorylation of a number of metabolic enzymes and transcription regulators. Activated by at least two distinct upstream kinases: the tumor suppressor LKB1 and CaMKK2. Also acts as a regulator of cellular polarity by remodeling the actin cytoskeleton, probably by indirectly activating myosin. AMPK is a heterotrimer of an alpha catalytic subunit (AMPKA1 or -2), a beta (AMPKB1 or -2) and a gamma non-catalytic subunit (AMPKG1, -2 or -3). Different possible combinations of subunits give rise to 12 different holoenzymes. Binding of ADP or AMP to non-catalytic gamma subunit (PRKAG1, -2 or -3) results in allosteric activation. AMPK is activated by antihyperglycemic drug metformin, a drug prescribed to patients with type 2 diabetes: in vivo, metformin seems to mainly inhibit liver gluconeogenesis. However, metformin can be used to activate AMPK in muscle and other cells in culture or ex vivo. Selectively inhibited by compound C (6-[4-(2-Piperidin-1-yl-ethoxy)-phenyl)]-3-pyridin-4-yl-pyyrazolo[1,5-a] pyrimidine. Activated by resveratrol, a natural polyphenol present in red wine, and S17834, a synthetic polyphenol. Two isoforms of the human protein are produced by alternative splicing.

Protein type: Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.26; Kinase, protein; EC 2.7.11.31; EC 2.7.11.27; Protein kinase, CAMK; Autophagy; EC 2.7.11.1; CAMK group; CAMKL family; AMPK subfamily

Chromosomal Location of Human Ortholog: 5p12

Cellular Component: AMP-activated protein kinase complex; cytoplasm; cytosol; intracellular; nucleoplasm; nucleus

Molecular Function: AMP-activated protein kinase activity; chromatin binding; histone serine kinase activity; protein binding; protein kinase activity

Biological Process: cell cycle arrest; cellular response to glucose starvation; cellular response to nutrient levels; fatty acid homeostasis; glucose homeostasis; lipid biosynthetic process; macroautophagy; negative regulation of apoptosis; negative regulation of lipid catabolic process; negative regulation of TOR signaling pathway; positive regulation of autophagy; positive regulation of glycolysis; protein amino acid phosphorylation; regulation of circadian rhythm; response to gamma radiation; signal transduction

Research Articles on PRKAA1

Similar Products

Product Notes

The PRKAA1 prkaa1 (Catalog #AAA1267156) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgacag ccgagaagca gaaacacgac gggcgggtga agatcggcca ctacattctg ggtgacacgc tgggggtcgg caccttcggc aaagtgaagg ttggcaaaca tgaattgact gggcataaag tagctgtgaa gatactcaat cgacagaaga ttcggagcct tgatgtggta ggaaaaatcc gcagagaaat tcagaacctc aagcttttca ggcatcctca tataattaaa ctgtaccagg tcatcagtac accatctgat attttcatgg tgatggaata tgtctcagga ggagagctat ttgattatat ctgtaagaat ggaaggctgg atgaaaaaga aagtcggcgt ctgttccaac agatcctttc tggtgtggat tattgtcaca ggcatatggt ggtccataga gatttgaaac ctgaaaatgt cctgcttgat gcacacatga atgcaaagat agctgatttt ggtctttcaa acatgatgtc agatggtgaa tttttaagaa caagttgtgg ctcacccaac tatgctgcac cagaagtaat ttcaggaaga ttgtatgcag gcccagaggt agatatatgg agcagtgggg ttattctcta tgctttatta tgtggaaccc ttccatttga tgatgaccat gtgccaactc tttttaagaa gatatgtgat gggatcttct atacccctca atatttaaat ccttctgtga ttagcctttt gaaacatatg ctgcaggtgg atcccatgaa gagggccaca atcaaagata tcagggaaca tgaatggttt aaacaggacc ttccaaaata tctctttcct gaggatccat catatagttc aaccatgatt gatgatgaag ccttaaaaga agtatgtgaa aagtttgagt gctcagaaga ggaagttctc agctgtcttt acaacagaaa tcaccaggat cctttggcag ttgcctacca tctcataata gataacagga gaataatgaa tgaagccaaa gatttctatt tggcgacaag cccacctgat tcttttcttg atgatcatca cctgactcgg ccccatcctg aaagagtacc attcttggtt gctgaaacac caagggcacg ccataccctt gatgaattaa atccacagaa atccaaacac caaggtgtaa ggaaagcaaa atggcattta ggaattagaa gtcaaagtcg accaaatgat attatggcag aagtatgtag agcaatcaaa caattggatt atgaatggaa ggttgtaaac ccatattatt tgcgtgtacg aaggaagaat cctgtgacaa gcacttactc caaaatgagt ctacagttat accaagtgga tagtagaact tatctactgg atttccgtag tattgatgat gaaattacag aagccaaatc agggactgct actccacaga gatcgggatc agttagcaac tatcgatctt gccaaaggag tgattcagat gctgaggctc aaggaaaatc ctcagaagtt tctcttacct catctgtgac ctcacttgac tcttctcctg ttgacctaac tccaagacct ggaagtcaca caatagaatt ttttgagatg tgtgcaaatc taattaaaat tcttgcacaa taa. It is sometimes possible for the material contained within the vial of "PRKAA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.