Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HPD cdna clone

HPD cDNA Clone

Gene Names
HPD; PPD; 4HPPD; GLOD3; 4-HPPD; HPPDASE
Synonyms
HPD; HPD cDNA Clone; HPD cdna clone
Ordering
For Research Use Only!
Sequence
atgacgacttacagtgacaaaggggcaaagcctgagagaggccgattcctccacttccactctgtgaccttctgggttggcaacgccaagcaggccgcgtcattctactgcagcaagatgggctttgaacctctagcctacaggggcctggagaccggttcccgggaggtggtcagccatgtaatcaaacaagggaagattgtgtttgtcctctcctcagcgctcaacccctggaacaaagagatgggcgatcacctggtgaaacacggtgacggagtgaaggacattgcgttcgaggtggaagattgtgactacatcgtgcagaaagcacgggaacggggcgccaaaatcatgcgggagccctgggtagagcaagacaagtttgggaaggtgaagtttgctgtgctgcagacgtatggggacaccacacacaccctggtggagaagatgaactacatcggccaattcttgcctggatatgaggccccagcgttcatggaccccctacttcctaaactgcccaaatgcagtctggagatgatcgaccacattgtgggaaaccagcctgatcaggagatggtgtccgcctccgaatggtacctgaaaaacctgcagttccaccgcttctggtccgtggatgacacgcaggtgcacacggaatatagctctctgcgatccattgtggtggccaactatgaagagtccatcaagatgcccatcaatgagccagcgcctggcaagaagaagtcccagatccaggaatatgtggactataacgggggcgctggggtccagcacatcgctctcaagaccgaagacatcatcacagcgattcgccacttgagagagagaggcctggagttcttatctgttccctccacgtactacaaacaactgcgggagaagctgaagacggccaagatcaaggtgaaggagaacattgatgccctggaggagctgaaaatcctggtggactacgacgagaaaggctacctcctgcagatcttcaccaaaccggtgcaggaccggcccacgctcttcctggaagtcatccagcgccacaaccaccagggttttggagccggcaacttcaactcactgttcaaggctttcgaggaggagcagaacctgcggggtaacctcaccaacatggagaccaatggggtggtgcccggcatgtaa
Sequence Length
1182
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,497 Da
NCBI Official Full Name
Homo sapiens 4-hydroxyphenylpyruvate dioxygenase, mRNA
NCBI Official Synonym Full Names
4-hydroxyphenylpyruvate dioxygenase
NCBI Official Symbol
HPD
NCBI Official Synonym Symbols
PPD; 4HPPD; GLOD3; 4-HPPD; HPPDASE
NCBI Protein Information
4-hydroxyphenylpyruvate dioxygenase
UniProt Protein Name
4-hydroxyphenylpyruvate dioxygenase
UniProt Gene Name
HPD
UniProt Synonym Gene Names
PPD; 4HPPD; HPD; HPPDase
UniProt Entry Name
HPPD_HUMAN

NCBI Description

The protein encoded by this gene is an enzyme in the catabolic pathway of tyrosine. The encoded protein catalyzes the conversion of 4-hydroxyphenylpyruvate to homogentisate. Defects in this gene are a cause of tyrosinemia type 3 (TYRO3) and hawkinsinuria (HAWK). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]

Uniprot Description

HPD: Key enzyme in the degradation of tyrosine. Defects in HPD are the cause of tyrosinemia type 3 (TYRO3). TYRO3 is an inborn error of metabolism characterized by elevations of tyrosine in the blood and urine, seizures and mild mental retardation. Defects in HPD are a cause of hawkinsinuria (HAWK). HAWK is an inborn error of tyrosine metabolism characterized by failure to thrive, persistent metabolic acidosis, fine and sparse hair, and excretion of the unusual cyclic amino acid metabolite, hawkinsin, in the urine. Belongs to the 4HPPD family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Amino Acid Metabolism - phenylalanine; Amino Acid Metabolism - tyrosine; Oxidoreductase; Cofactor and Vitamin Metabolism - ubiquinone and other terpenoid-quinone biosynthesis; EC 1.13.11.27

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: cytosol

Molecular Function: 4-hydroxyphenylpyruvate dioxygenase activity

Biological Process: L-phenylalanine catabolic process; tyrosine catabolic process

Disease: Hawkinsinuria; Tyrosinemia, Type Iii

Research Articles on HPD

Similar Products

Product Notes

The HPD hpd (Catalog #AAA1267107) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgactt acagtgacaa aggggcaaag cctgagagag gccgattcct ccacttccac tctgtgacct tctgggttgg caacgccaag caggccgcgt cattctactg cagcaagatg ggctttgaac ctctagccta caggggcctg gagaccggtt cccgggaggt ggtcagccat gtaatcaaac aagggaagat tgtgtttgtc ctctcctcag cgctcaaccc ctggaacaaa gagatgggcg atcacctggt gaaacacggt gacggagtga aggacattgc gttcgaggtg gaagattgtg actacatcgt gcagaaagca cgggaacggg gcgccaaaat catgcgggag ccctgggtag agcaagacaa gtttgggaag gtgaagtttg ctgtgctgca gacgtatggg gacaccacac acaccctggt ggagaagatg aactacatcg gccaattctt gcctggatat gaggccccag cgttcatgga ccccctactt cctaaactgc ccaaatgcag tctggagatg atcgaccaca ttgtgggaaa ccagcctgat caggagatgg tgtccgcctc cgaatggtac ctgaaaaacc tgcagttcca ccgcttctgg tccgtggatg acacgcaggt gcacacggaa tatagctctc tgcgatccat tgtggtggcc aactatgaag agtccatcaa gatgcccatc aatgagccag cgcctggcaa gaagaagtcc cagatccagg aatatgtgga ctataacggg ggcgctgggg tccagcacat cgctctcaag accgaagaca tcatcacagc gattcgccac ttgagagaga gaggcctgga gttcttatct gttccctcca cgtactacaa acaactgcgg gagaagctga agacggccaa gatcaaggtg aaggagaaca ttgatgccct ggaggagctg aaaatcctgg tggactacga cgagaaaggc tacctcctgc agatcttcac caaaccggtg caggaccggc ccacgctctt cctggaagtc atccagcgcc acaaccacca gggttttgga gccggcaact tcaactcact gttcaaggct ttcgaggagg agcagaacct gcggggtaac ctcaccaaca tggagaccaa tggggtggtg cccggcatgt aa. It is sometimes possible for the material contained within the vial of "HPD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.