Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DPY19L4 cdna clone

DPY19L4 cDNA Clone

Synonyms
DPY19L4; DPY19L4 cDNA Clone; DPY19L4 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggaggaagaaggaccacctgtagagctgcgccaaagaaaaaagccaaagtcttcagaaaataaggaatctgccaaagaagagaaaatcagtgacattccaattcctgaaagagctccaaaacatgtattatttcaacgctttgcaaagattttcattggctgtcttgcagcagttactagtggtatgatgtatgctctctacttatcagcataccatgaacggaaattctggttttccaacaggcaggagcttgaacgggaaatcacgtttcagggtgacagtgccatttattactcctattataaagatatgttaaaggcaccttcatttgaaagaggtgtttacgaactgacacacaataacaaaactgtatctctgaagactataaatgcagtgcagcaaatgtctctgtatccggaacttattgctagcattttatatcaagccactggtagcaatgagattattgagccagtgtatttctatattggcattgtttttggattgcaaggaatatatgttactgctttatttgttacaagttggcttatgagtggaacatggctagcaggaatgcttactgttgcgtggttcgttattaacagggtagatacaacaagaattgaatactccattcctttaagagaaaactgggcactaccatattttgcatgccaaattgctgcacttacaggctatttaaaaagcaacttaaatacttatggagagaggttttgctacttgttgatgagtgcttcaacttacacatttatgatgatgtgggagtatagccactatctcctgtttcttcaagcaatatctctattcctgctagataccttttcagtggagcaaagtgacaaggtttatgaagtttataaaatctacatattttccctctttctgggatatttactacagtttgagaatccagctttgttggtatctcctttattaagtttagtagcagccttaatgcttgctaagtgccttcagctgaatgtgaagaaaggaagttttgtagctaaaataataaaagtgattaatttttacttggtgtgtactctgacaataacattgaatattataatgaagatgtttgtcccacacaaagaaaatgggcacatgctgaaattccttgaagtaaaatttggactaaatatgaccaagaattttacaatgaattggctcctctgtcaagaatccctgcaggcaccatctcaagatttttttctgcgattgacacagtcttctttattacctttctacattctagtgttaattatttgttttctttctatgttgcaagttatttttaggaggattaatggtaagtccctgaaggaaactgttactcttgaagatggacgaattggagaaagaccagaaataatttatcatgtaattcacactattttattgggttctcttgcaatggttatagaaggcttgaagtacatctggattccttatgtgtgcatgttagcagcatttggtgtatgttctcccgaactttggatgacacttttcaagtggcttcgattaagaactgtacacccaatattgttggctcttattctgagcatggccgtgcctactataataggtctcagcttatggaaagagttttttcccagattaatgacagaattaatggaactacaggaattctatgacccagatacagtggaacttatgacctggataaaaaggcaagctccagttgcagctgtgtttgcagggagtccacagttaatgggtgcgattaaattatgcactggatggatggtgacaagtttgcctctttacaatgatgatgatcttctcaagagaaatgaaaatatctaccaaatctattcaaagcgatctgctgaggatatttataaaatactgacatcttacaaagctaattacctaattgtagaggatgctatctgcaatgaggtgggacccatgagaggctgtagggttaaagatttattagacattgcaaatggccacatggtttgtgaagaaggtgacaagctaacctactcaaaatatgggcgattttgtcatgaggtcaaaattaactattctccatatgtgaattatttcactagagtatactggaacagatcctactttgtatataaaatcaacactgtgatatccttccagtcttga
Sequence Length
2172
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
83,756 Da
NCBI Official Full Name
Homo sapiens dpy-19-like 4 (C. elegans), mRNA
NCBI Official Synonym Full Names
dpy-19 like 4 (C. elegans)
NCBI Official Symbol
DPY19L4
NCBI Protein Information
probable C-mannosyltransferase DPY19L4
UniProt Protein Name
Probable C-mannosyltransferase DPY19L4
UniProt Gene Name
DPY19L4
UniProt Entry Name
D19L4_HUMAN

Uniprot Description

DPY19L4: Belongs to the dpy-19 family.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 8q22.1

Cellular Component: nuclear inner membrane

Molecular Function: mannosyltransferase activity

Biological Process: protein amino acid C-linked glycosylation via 2'-alpha-mannosyl-L-tryptophan

Similar Products

Product Notes

The DPY19L4 dpy19l4 (Catalog #AAA1267089) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagg aagaaggacc acctgtagag ctgcgccaaa gaaaaaagcc aaagtcttca gaaaataagg aatctgccaa agaagagaaa atcagtgaca ttccaattcc tgaaagagct ccaaaacatg tattatttca acgctttgca aagattttca ttggctgtct tgcagcagtt actagtggta tgatgtatgc tctctactta tcagcatacc atgaacggaa attctggttt tccaacaggc aggagcttga acgggaaatc acgtttcagg gtgacagtgc catttattac tcctattata aagatatgtt aaaggcacct tcatttgaaa gaggtgttta cgaactgaca cacaataaca aaactgtatc tctgaagact ataaatgcag tgcagcaaat gtctctgtat ccggaactta ttgctagcat tttatatcaa gccactggta gcaatgagat tattgagcca gtgtatttct atattggcat tgtttttgga ttgcaaggaa tatatgttac tgctttattt gttacaagtt ggcttatgag tggaacatgg ctagcaggaa tgcttactgt tgcgtggttc gttattaaca gggtagatac aacaagaatt gaatactcca ttcctttaag agaaaactgg gcactaccat attttgcatg ccaaattgct gcacttacag gctatttaaa aagcaactta aatacttatg gagagaggtt ttgctacttg ttgatgagtg cttcaactta cacatttatg atgatgtggg agtatagcca ctatctcctg tttcttcaag caatatctct attcctgcta gatacctttt cagtggagca aagtgacaag gtttatgaag tttataaaat ctacatattt tccctctttc tgggatattt actacagttt gagaatccag ctttgttggt atctccttta ttaagtttag tagcagcctt aatgcttgct aagtgccttc agctgaatgt gaagaaagga agttttgtag ctaaaataat aaaagtgatt aatttttact tggtgtgtac tctgacaata acattgaata ttataatgaa gatgtttgtc ccacacaaag aaaatgggca catgctgaaa ttccttgaag taaaatttgg actaaatatg accaagaatt ttacaatgaa ttggctcctc tgtcaagaat ccctgcaggc accatctcaa gatttttttc tgcgattgac acagtcttct ttattacctt tctacattct agtgttaatt atttgttttc tttctatgtt gcaagttatt tttaggagga ttaatggtaa gtccctgaag gaaactgtta ctcttgaaga tggacgaatt ggagaaagac cagaaataat ttatcatgta attcacacta ttttattggg ttctcttgca atggttatag aaggcttgaa gtacatctgg attccttatg tgtgcatgtt agcagcattt ggtgtatgtt ctcccgaact ttggatgaca cttttcaagt ggcttcgatt aagaactgta cacccaatat tgttggctct tattctgagc atggccgtgc ctactataat aggtctcagc ttatggaaag agttttttcc cagattaatg acagaattaa tggaactaca ggaattctat gacccagata cagtggaact tatgacctgg ataaaaaggc aagctccagt tgcagctgtg tttgcaggga gtccacagtt aatgggtgcg attaaattat gcactggatg gatggtgaca agtttgcctc tttacaatga tgatgatctt ctcaagagaa atgaaaatat ctaccaaatc tattcaaagc gatctgctga ggatatttat aaaatactga catcttacaa agctaattac ctaattgtag aggatgctat ctgcaatgag gtgggaccca tgagaggctg tagggttaaa gatttattag acattgcaaa tggccacatg gtttgtgaag aaggtgacaa gctaacctac tcaaaatatg ggcgattttg tcatgaggtc aaaattaact attctccata tgtgaattat ttcactagag tatactggaa cagatcctac tttgtatata aaatcaacac tgtgatatcc ttccagtctt ga. It is sometimes possible for the material contained within the vial of "DPY19L4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.