Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL2 cdna clone

IL2 cDNA Clone

Gene Names
IL2; IL-2; TCGF; lymphokine
Synonyms
IL2; IL2 cDNA Clone; IL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtacaggatgcaactcctgtcttgcattgcactaagtcttgcacttgtcacaaacagtgcacctacttcaagttctacaaagaaaacacagctacaactggagcatttactgctggatttacagatgattttgaatggaattaataattacaagaatcccaaactcaccaggatgctcacatttaagttttacatgcccaagaaggccacagaactgaaacatcttcagtgtctagaagaagaactcaaacctctggaggaagtgctaaatttagctcaaagcaaaaactttcacttaagacccagggacttaatcagcaatatcaacgtaatagttctggaactaaagggatctgaaacaacattcatgtgtgaatatgctgatgagacagcaaccattgtagaatttctgaacagatggattaccttttgtcaaagcatcatctcaacactgacttga
Sequence Length
462
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,628 Da
NCBI Official Full Name
Homo sapiens interleukin 2, mRNA
NCBI Official Synonym Full Names
interleukin 2
NCBI Official Symbol
IL2
NCBI Official Synonym Symbols
IL-2; TCGF; lymphokine
NCBI Protein Information
interleukin-2
UniProt Protein Name
Interleukin-2
Protein Family
UniProt Gene Name
IL2
UniProt Synonym Gene Names
IL-2; TCGF
UniProt Entry Name
IL2_HUMAN

NCBI Description

The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]

Uniprot Description

IL2: Produced by T-cells in response to antigenic or mitogenic stimulation, this protein is required for T-cell proliferation and other activities crucial to regulation of the immune response. Can stimulate B-cells, monocytes, lymphokine- activated killer cells, natural killer cells, and glioma cells. A chromosomal aberration involving IL2 is found in a form of T-cell acute lymphoblastic leukemia (T-ALL). Translocation t(4;16)(q26;p13) with involves TNFRSF17. Belongs to the IL-2 family.

Protein type: Secreted; Cytokine; Secreted, signal peptide; Oncoprotein

Chromosomal Location of Human Ortholog: 4q26-q27

Cellular Component: extracellular region; extracellular space

Molecular Function: cytokine activity; growth factor activity; interleukin-2 receptor binding; kinase activator activity; Ras guanyl-nucleotide exchange factor activity

Biological Process: cell adhesion; cell-cell signaling; immune response; MAPKKK cascade; natural killer cell activation; negative regulation of apoptosis; negative regulation of B cell apoptosis; positive regulation of activated T cell proliferation; positive regulation of B cell proliferation; positive regulation of cell growth; positive regulation of cell proliferation; positive regulation of inflammatory response; positive regulation of interleukin-17 production; positive regulation of tissue remodeling; positive regulation of tyrosine phosphorylation of Stat5 protein; T cell differentiation

Research Articles on IL2

Similar Products

Product Notes

The IL2 il2 (Catalog #AAA1267020) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacaaacagt gcacctactt caagttctac aaagaaaaca cagctacaac tggagcattt actgctggat ttacagatga ttttgaatgg aattaataat tacaagaatc ccaaactcac caggatgctc acatttaagt tttacatgcc caagaaggcc acagaactga aacatcttca gtgtctagaa gaagaactca aacctctgga ggaagtgcta aatttagctc aaagcaaaaa ctttcactta agacccaggg acttaatcag caatatcaac gtaatagttc tggaactaaa gggatctgaa acaacattca tgtgtgaata tgctgatgag acagcaacca ttgtagaatt tctgaacaga tggattacct tttgtcaaag catcatctca acactgactt ga. It is sometimes possible for the material contained within the vial of "IL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.