Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PGBD4 cdna clone

PGBD4 cDNA Clone

Synonyms
PGBD4; PGBD4 cDNA Clone; PGBD4 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaaatcctagaaaacgtagcattcctatgcgtgatagtaataccggtctcgaacagttgttggctgaagattcatttgatgaatctgatttttcggaaatagatgattctgataatttttcggatagtgctttagaagccgataagatcaggcctctgtcccatttagaatctgatggaaagagctctacatcaagtgactcagggcgctccatgaaatggtcagctcgtgctatgattccacgtcaaaggtatgactttaccggcacacctggcagaaaagtcgatgtcagtgatatcactgacccattgcagtattttgaactgttctttactgaggaattagtttcaaaaattactagagaaacaaatgcccaagctgccttgttggcttcaaagccaccgggtccgaaaggattttcgcgaatggataaatggaaagacactgacaatgacgagctcaaagtcttttttgcagtaatgttactgcaaggtattgtgcagaaacctgagctggagatgttttggtcaacaaggcctcttttggatacaccttatctcaggcaaattatgactggtgaaagatttttacttttgtttcggtgcctgcattttgtcaacaattcttctatatctgctggtcaatcaaaggcccagatttcattgcagaagatcaaacctgtgttcgactttcttgtaaataaattttccactgtatatactccaaacagaaacattgcagttgatgaatcactgatgctgttcaaggggccattagctatgaagcagtacctcccgacaaaacgagtacgatttggtctgaagctatatgtactttgtgaaagtcagtctggttatgtgtggaatgcgcttgttcacacagggcctggcatgaatttgaaagattcagcggatggcctgaaatcatcacgcattgttcttaccttggtcaatgaccttcttggccaagggtattgtgtcttcctcgataactttaatatatctcccatgcttttcagagaattacatcaaaataggactgatgcagttgggacagctcgtttgaacagaaaacagattccaaatgatctgaaaaaaaggattgcaaaggggacgactgtagccagattctgtggtgaacttatggcactgaaatggtgtgacggcaaggaggtgacaatgttgtcaacattccacaatgatactgtgattgaagtaaacaatagaaatggaaagaaaactaaaaggccacgtgtcattgtggattataacgagaatatgggagcagtggactcggctgatcaaatgcttacttcttatccatctgagcgcaaaagacacaaggtttggtataagaaattctttcaccatcttctacacattacagtgctgaactcctacatcctgttcaagaaggataatcctgagcacacgatgagccatataaacttcagactggcattgattgaaagaatgctggaaaagcatcacaagccagggcagcaacatcttcgaggtcgtccttgctccgatgatgtcacacctcttcgtctgtctggaagacatttccccaagagcataccagcaacgtccgggaaacagaatccaactggtcgctgcaaaatttgctgctcccaatacgacaaggatggcaagaagatccggaaagaaacgcgctatttttgtgccgaatgtgatgttccgctttgtgttgttccgtgctttgaaatttaccacacgaaaaaaaattattaa
Sequence Length
1758
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,004 Da
NCBI Official Full Name
Homo sapiens piggyBac transposable element derived 4, mRNA
NCBI Official Synonym Full Names
piggyBac transposable element derived 4
NCBI Official Symbol
PGBD4
NCBI Protein Information
piggyBac transposable element-derived protein 4
UniProt Protein Name
PiggyBac transposable element-derived protein 4
UniProt Gene Name
PGBD4
UniProt Entry Name
PGBD4_HUMAN

NCBI Description

The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes, including human, that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. [provided by RefSeq, Jul 2008]

Uniprot Description

PGBD4:

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 15q14

Similar Products

Product Notes

The PGBD4 pgbd4 (Catalog #AAA1266896) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaaatc ctagaaaacg tagcattcct atgcgtgata gtaataccgg tctcgaacag ttgttggctg aagattcatt tgatgaatct gatttttcgg aaatagatga ttctgataat ttttcggata gtgctttaga agccgataag atcaggcctc tgtcccattt agaatctgat ggaaagagct ctacatcaag tgactcaggg cgctccatga aatggtcagc tcgtgctatg attccacgtc aaaggtatga ctttaccggc acacctggca gaaaagtcga tgtcagtgat atcactgacc cattgcagta ttttgaactg ttctttactg aggaattagt ttcaaaaatt actagagaaa caaatgccca agctgccttg ttggcttcaa agccaccggg tccgaaagga ttttcgcgaa tggataaatg gaaagacact gacaatgacg agctcaaagt cttttttgca gtaatgttac tgcaaggtat tgtgcagaaa cctgagctgg agatgttttg gtcaacaagg cctcttttgg atacacctta tctcaggcaa attatgactg gtgaaagatt tttacttttg tttcggtgcc tgcattttgt caacaattct tctatatctg ctggtcaatc aaaggcccag atttcattgc agaagatcaa acctgtgttc gactttcttg taaataaatt ttccactgta tatactccaa acagaaacat tgcagttgat gaatcactga tgctgttcaa ggggccatta gctatgaagc agtacctccc gacaaaacga gtacgatttg gtctgaagct atatgtactt tgtgaaagtc agtctggtta tgtgtggaat gcgcttgttc acacagggcc tggcatgaat ttgaaagatt cagcggatgg cctgaaatca tcacgcattg ttcttacctt ggtcaatgac cttcttggcc aagggtattg tgtcttcctc gataacttta atatatctcc catgcttttc agagaattac atcaaaatag gactgatgca gttgggacag ctcgtttgaa cagaaaacag attccaaatg atctgaaaaa aaggattgca aaggggacga ctgtagccag attctgtggt gaacttatgg cactgaaatg gtgtgacggc aaggaggtga caatgttgtc aacattccac aatgatactg tgattgaagt aaacaataga aatggaaaga aaactaaaag gccacgtgtc attgtggatt ataacgagaa tatgggagca gtggactcgg ctgatcaaat gcttacttct tatccatctg agcgcaaaag acacaaggtt tggtataaga aattctttca ccatcttcta cacattacag tgctgaactc ctacatcctg ttcaagaagg ataatcctga gcacacgatg agccatataa acttcagact ggcattgatt gaaagaatgc tggaaaagca tcacaagcca gggcagcaac atcttcgagg tcgtccttgc tccgatgatg tcacacctct tcgtctgtct ggaagacatt tccccaagag cataccagca acgtccggga aacagaatcc aactggtcgc tgcaaaattt gctgctccca atacgacaag gatggcaaga agatccggaa agaaacgcgc tatttttgtg ccgaatgtga tgttccgctt tgtgttgttc cgtgctttga aatttaccac acgaaaaaaa attattaa. It is sometimes possible for the material contained within the vial of "PGBD4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.