PANK2 cdna clone

PANK2 cDNA Clone

Cat. Num. AAA1266801

• Gene Names: PANK2; HSS; HARP; PKAN; NBIA1; C20orf48
• Synonyms: PANK2; PANK2 cDNA Clone; PANK2 cdna clone

• Sequence: atggcatctcgtggagatagcaccaaagtggataaactagtacgagatatttatggaggggactatgagaggtttggactgccaggctgggctgtggcttcaagctttggaaacatgatgagcaaggagaagcgagaggctgtcagtaaagaggacctggccagagcgactttgatcaccatcaccaacaacattggctcaatagcaagaatgtgtgcccttaatgaaaacattaaccaggtggtatttgttggaaatttcttgagaattaatacgatcgccatgcggcttttggcatatgctttggattattggtccaaggggcagttgaaagcacttttttcggaacacgagggttattttggagctgttggagcactccttgagctgttgaagatcccgtga
• Sequence Length: 405

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 14495628
• NCBI GeneID: 80025
• Molecular Weight: 50,582 Da
• NCBI Official Full Name: Homo sapiens pantothenate kinase 2 (Hallervorden-Spatz syndrome), mRNA
• NCBI Official Synonym Full Names: pantothenate kinase 2
• NCBI Official Symbol: PANK2
• NCBI Official Synonym Symbols: HSS; HARP; PKAN; NBIA1; C20orf48
• NCBI Protein Information: pantothenate kinase 2, mitochondrial
• UniProt Protein Name: Pantothenate kinase 2, mitochondrial
• Protein Family: Pantothenate kinase
• UniProt Gene Name: PANK2
• UniProt Synonym Gene Names: C20orf48; hPanK2
• UniProt Entry Name: PANK2_HUMAN

NCBI Description

This gene encodes a protein belonging to the pantothenate kinase family and is the only member of that family to be expressed in mitochondria. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by acyl CoA species. Mutations in this gene are associated with HARP syndrome and pantothenate kinase-associated neurodegeneration (PKAN), formerly Hallervorden-Spatz syndrome. Alternative splicing, involving the use of alternate first exons, results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

PANK2: a pantothenate kinase that catalyzes the first committed step in the biosynthesis of coenzyme A, an essential cofactor in cellular metabolism. PANK2 is predominantly localized in mitochondria in primates. Defects in PANK2 are the cause of pantothenate kinase-associated neurodegeneration (PKAN), an autosomal recessive neurodegenerative disorder associated with iron accumulation in the brain. Three isoforms of the human PANK2, produced by alternative splicing, have been reported.

Protein type: EC 2.7.1.33; Cofactor and Vitamin Metabolism - pantothenate and CoA biosynthesis; Kinase, other; Mitochondrial

Chromosomal Location of Human Ortholog: 20p13

Cellular Component: cytoplasm; mitochondrial intermembrane space

Molecular Function: pantothenate kinase activity

Biological Process: coenzyme biosynthetic process; regulation of fatty acid metabolic process

Disease: Hypoprebetalipoproteinemia, Acanthocytosis, Retinitis Pigmentosa, And Pallidal Degeneration; Neurodegeneration With Brain Iron Accumulation 1