GGTLC1 cdna clone
GGTLC1 cDNA Clone
Synonyms
GGTLC1; GGTLC1 cDNA Clone; GGTLC1 cdna clone
Sequence
atgacctccgagttcttctctgcccagctccgggcccagatctctgacgacaccactcacccgatctcctactacaagcccgagttctacatgccggatgacgggggcactgctcacctgtctgtggtcgcagaggacggcagtgctgtgtccgccaccagcaccatcaacctctactttggctccaaggtgcgctccccagtcagcgggatcctgctcaataatgaaatggatgacttcagctctaccagcatcaccaacgagtttggggtacccccctcacctgccaatttcatccagccagggaagcagccgctctcgtccatgtgcccgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgccgggggcacgcagatcaccatggccactgcactggccatcatctacaacctctggttcggctatgacgtgaagtgggccgtggaggagccccggctgcacaaccagcttctgcccaacgtcacgacagtggagagaaacattgaccaggaagtgactgcagccctggagacccggcaccatcacacccagatcacgtccaccttcattgctgtggtgcaagccatcgtccgcatggctggtggctgggcagctgcctcggactccaggaaaggtggggaacctgctggctactga
Sequence Length
678
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
24,274 Da
NCBI Official Full Name
Homo sapiens gamma-glutamyltransferase light chain 1, mRNA
UniProt Protein Name
Gamma-glutamyltransferase light chain 1
Protein Family
UniProt Gene Name
GGTLC1
UniProt Synonym Gene Names
GGTLA4
UniProt Entry Name
GGTL1_HUMAN
Uniprot Description
GGTLC1: Belongs to the gamma-glutamyltransferase family
Chromosomal Location of Human Ortholog: 20p11.1
Cellular Component: anchored to external side of plasma membrane
Molecular Function: gamma-glutamyltransferase activity
Biological Process: glutathione metabolic process; leukotriene biosynthetic process
Similar Products
Product Notes
The GGTLC1 ggtlc1 (Catalog #AAA1266778) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacctccg agttcttctc tgcccagctc cgggcccaga tctctgacga caccactcac ccgatctcct actacaagcc cgagttctac atgccggatg acgggggcac tgctcacctg tctgtggtcg cagaggacgg cagtgctgtg tccgccacca gcaccatcaa cctctacttt ggctccaagg tgcgctcccc agtcagcggg atcctgctca ataatgaaat ggatgacttc agctctacca gcatcaccaa cgagtttggg gtacccccct cacctgccaa tttcatccag ccagggaagc agccgctctc gtccatgtgc ccgacgatca tggtgggcca ggacggccag gtccggatgg tggtgggagc tgccgggggc acgcagatca ccatggccac tgcactggcc atcatctaca acctctggtt cggctatgac gtgaagtggg ccgtggagga gccccggctg cacaaccagc ttctgcccaa cgtcacgaca gtggagagaa acattgacca ggaagtgact gcagccctgg agacccggca ccatcacacc cagatcacgt ccaccttcat tgctgtggtg caagccatcg tccgcatggc tggtggctgg gcagctgcct cggactccag gaaaggtggg gaacctgctg gctactga. It is sometimes possible for the material contained within the vial of "GGTLC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
