Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMEM216 cdna clone

TMEM216 cDNA Clone

Gene Names
TMEM216; HSPC244
Synonyms
TMEM216; TMEM216 cDNA Clone; TMEM216 cdna clone
Ordering
For Research Use Only!
Sequence
atgctcctcctttatcttggaattgaagtaattcgcctgttttttggtacaaagggaaacctctgccagcgaaagatgccactcagtattagcgtggccttgaccttcccatctgccatgatggcctcctattacctgctgctgcagacctacgtactccgcctggaagccatcatgaatggcatcttgctcttcttctgtggctcagagcttttacttgaggtgctcaccttggctgctttctccagtatggacacgatttga
Sequence Length
264
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,820 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 216, mRNA
NCBI Official Synonym Full Names
transmembrane protein 216
NCBI Official Symbol
TMEM216
NCBI Official Synonym Symbols
HSPC244
NCBI Protein Information
transmembrane protein 216
UniProt Protein Name
Transmembrane protein 216
Protein Family
UniProt Gene Name
TMEM216
UniProt Entry Name
TM216_HUMAN

NCBI Description

This locus encodes a transmembrane domain-containing protein. Mutations at this locus have been associated with Meckel-Gruber Syndrome Type 2, and Joubert Syndrome 2, also known as Cerebello-oculorenal Syndrome 2. [provided by RefSeq, Aug 2010]

Uniprot Description

TMEM216: Part of the tectonic-like complex which is required for tissue-specific ciliogenesis and may regulate ciliary membrane composition. Defects in TMEM216 are a cause of Joubert syndrome type 2 (JBTS2). JBTS2 is a disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy and renal disease. Defects in TMEM216 are the cause of Meckel syndrome type 2 (MKS2). It is a form of Meckel syndrome, an autosomal recessive disorder. It is characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 11q13.1

Cellular Component: cilium; cytosol

Biological Process: cilium biogenesis

Disease: Joubert Syndrome 2; Meckel Syndrome, Type 2

Research Articles on TMEM216

Similar Products

Product Notes

The TMEM216 tmem216 (Catalog #AAA1266744) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcctcc tttatcttgg aattgaagta attcgcctgt tttttggtac aaagggaaac ctctgccagc gaaagatgcc actcagtatt agcgtggcct tgaccttccc atctgccatg atggcctcct attacctgct gctgcagacc tacgtactcc gcctggaagc catcatgaat ggcatcttgc tcttcttctg tggctcagag cttttacttg aggtgctcac cttggctgct ttctccagta tggacacgat ttga. It is sometimes possible for the material contained within the vial of "TMEM216, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.