Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANKMY1 cdna clone

ANKMY1 cDNA Clone

Gene Names
ANKMY1; ZMYND13
Synonyms
ANKMY1; ANKMY1 cDNA Clone; ANKMY1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaggggcccatgcctcccttagcttagaggacgaagtctctggggctggcagccgccaacgcccgctagaggggaagggcggcgagacccctgctgccgaggagccggggtccctgaagaactacgctgtcttcgccacaagggatgtttcagcagcccctgagaaggaagaggaggaagctgagggcccgctgagggcgcaggacctgagggagtcctacatccagctcgtccagggtgtgcaggagtggcaggatggttgcatgtaccagggggagtttgggttgaacatgaagcttggatatggcaaattctcttggcccacaggcgagtcataccatgggcagttttaccgggaccactgccatggcctgggtacctacatgtggccagatggctccagtttcacgggcacattttacctcagccaccgagaaggctacggcaccatgtacatgaagacacggcttttccagactcactgccacaacgacattgtcaaccttctcctggactgtggggccgacgtgaacaagtgctcagatgagggtctcacggcactcagcatgtgtttcctcctccactaccccgcccagtccttcaagcccaatgttgctgaacggaccatacctgagccccaggaacctccaaaattcccagttgttccaatcctttcatcatcatttatggacacaaacctggagtctctgtactatgaggtgaacgtgccttcccagggtagctatgagctgaggccaccgccagcaccactgctcctgccacgcgtctcaggcagccacgagggcggccacttccaggacaccgggcagtgtggggggtccatagaccacaggagcagctctctgaagggggactccccgttggtgaagggcagccttggccatgtggaaagcgggcttgaggacgtgttgggaaacacagaccggggcagtctgtgcagtgctgagacgaaatttgagtccaacgtgtgtgtgtgcgacttctccatcgagctctcgcaggccatgctggagagaagcgcccagtcccacagcttgctgaagatggcctcgccctcaccgtgcaccagcagcttcgacaaagggaccatgcggaggatggcgctgtccatgatcgagcggaggaagcgctggcggaccatcaagctgctgctgcgccggggcgcggaccccaacctgtgctgcgtgcccatgcaggtcctgttccttgctgtgaaggccggggacgtggatggggtgaggctgctgctggagcacggggcgaggaccgacatctgctttccgccgcagtgttga
Sequence Length
1320
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
79,259 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and MYND domain containing 1, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and MYND domain containing 1
NCBI Official Symbol
ANKMY1
NCBI Official Synonym Symbols
ZMYND13
NCBI Protein Information
ankyrin repeat and MYND domain-containing protein 1
UniProt Protein Name
Ankyrin repeat and MYND domain-containing protein 1
UniProt Gene Name
ANKMY1
UniProt Synonym Gene Names
TSAL1; ZMYND13
UniProt Entry Name
ANKY1_HUMAN

Uniprot Description

ANKMY1: 4 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 2q37.3

Research Articles on ANKMY1

Similar Products

Product Notes

The ANKMY1 ankmy1 (Catalog #AAA1266658) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagggg cccatgcctc ccttagctta gaggacgaag tctctggggc tggcagccgc caacgcccgc tagaggggaa gggcggcgag acccctgctg ccgaggagcc ggggtccctg aagaactacg ctgtcttcgc cacaagggat gtttcagcag cccctgagaa ggaagaggag gaagctgagg gcccgctgag ggcgcaggac ctgagggagt cctacatcca gctcgtccag ggtgtgcagg agtggcagga tggttgcatg taccaggggg agtttgggtt gaacatgaag cttggatatg gcaaattctc ttggcccaca ggcgagtcat accatgggca gttttaccgg gaccactgcc atggcctggg tacctacatg tggccagatg gctccagttt cacgggcaca ttttacctca gccaccgaga aggctacggc accatgtaca tgaagacacg gcttttccag actcactgcc acaacgacat tgtcaacctt ctcctggact gtggggccga cgtgaacaag tgctcagatg agggtctcac ggcactcagc atgtgtttcc tcctccacta ccccgcccag tccttcaagc ccaatgttgc tgaacggacc atacctgagc cccaggaacc tccaaaattc ccagttgttc caatcctttc atcatcattt atggacacaa acctggagtc tctgtactat gaggtgaacg tgccttccca gggtagctat gagctgaggc caccgccagc accactgctc ctgccacgcg tctcaggcag ccacgagggc ggccacttcc aggacaccgg gcagtgtggg gggtccatag accacaggag cagctctctg aagggggact ccccgttggt gaagggcagc cttggccatg tggaaagcgg gcttgaggac gtgttgggaa acacagaccg gggcagtctg tgcagtgctg agacgaaatt tgagtccaac gtgtgtgtgt gcgacttctc catcgagctc tcgcaggcca tgctggagag aagcgcccag tcccacagct tgctgaagat ggcctcgccc tcaccgtgca ccagcagctt cgacaaaggg accatgcgga ggatggcgct gtccatgatc gagcggagga agcgctggcg gaccatcaag ctgctgctgc gccggggcgc ggaccccaac ctgtgctgcg tgcccatgca ggtcctgttc cttgctgtga aggccgggga cgtggatggg gtgaggctgc tgctggagca cggggcgagg accgacatct gctttccgcc gcagtgttga. It is sometimes possible for the material contained within the vial of "ANKMY1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.