Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ENTPD1 cdna clone

ENTPD1 cDNA Clone

Gene Names
ENTPD1; CD39; SPG64; ATPDase; NTPDase-1
Synonyms
ENTPD1; ENTPD1 cDNA Clone; ENTPD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaagtgaagagttggcagacagggttctggatgtggtggagaggagcctcagcaactacccctttgacttccagggtgccaggatcattactggccaagaggaaggtgcctatggctggattactatcaactatctgctgggcaaattcagtcagaaaacaaggtggttcagcatagtcccatatgaaaccaataatcaggaaacctttggagctttggaccttgggggagcctctacacaagtcacttttgtaccccaaaaccagactatcgagtccccagataatgctctgcaatttcgcctctatggcaaggactacaatgtctacacacatagcttcttgtgctatgggaaggatcaggcactctggcagaaactggccaaggacattcaggttgcaagtaatgaaattctcagggacccatgctttcatcctggatataagaaggtagtgaacgtaagtgacctttacaagaccccctgcaccaagagatttgagatgactcttccattccagcagtttgaaatccagggtattggaaactatcaacaatgccatcaaagcatcctggagctcttcaacaccagttactgcccttactcccagtgtgccttcaatgggattttcttgccaccactccagggggattttggggcattttcagctttttactttgtgatgaagtttttaaacttgacatcagagaaagtctctcaggaaaaggtgactgagatgatgaaaaagttctgtgctcagccttgggaggagataaaaacatcttacgctggagtaaaggagaagtacctgagtgaatactgcttttctggtacctacattctctccctccttctgcaaggctatcatttcacagctgattcctgggagcacatccatttcattggcaagatccagggcagcgacgccggctggactttgggctacatgctgaacctgaccaacatgatcccagctgagcaaccattgtccacacctctctcccactccacctatgtcttcctcatggttctattctccctggtccttttcacagtggccatcataggcttgcttatctttcacaagccttcatatttctggaaagatatggtatag
Sequence Length
1119
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
953
Molecular Weight
59,325 Da
NCBI Official Full Name
Homo sapiens ectonucleoside triphosphate diphosphohydrolase 1, mRNA
NCBI Official Synonym Full Names
ectonucleoside triphosphate diphosphohydrolase 1
NCBI Official Symbol
ENTPD1
NCBI Official Synonym Symbols
CD39; SPG64; ATPDase; NTPDase-1
NCBI Protein Information
ectonucleoside triphosphate diphosphohydrolase 1
UniProt Protein Name
Ectonucleoside triphosphate diphosphohydrolase 1
UniProt Gene Name
ENTPD1
UniProt Synonym Gene Names
CD39; NTPDase 1; Ecto-ATPDase 1; Ecto-ATPase 1
UniProt Entry Name
ENTP1_HUMAN

NCBI Description

The protein encoded by this gene is a plasma membrane protein that hydrolyzes extracellular ATP and ADP to AMP. Inhibition of this protein's activity may confer anticancer benefits. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]

Uniprot Description

ENTPD1: an ectonucleotidase that, like CD73, hydrolyzes immunostimulatory ATP, and ADP, to immunosuppressive AMP. May inhibit host immune responses against cancer. Expressed at high levels in malignant epithelial cells of human rectal adenocarcinoma. A prognostic marker of chronic lymphocytic leukemia that may identify patients with an unfavorable clinical outcome. Synergizes with CD161 to modulate Th17 responses in Crohn's disease. It may hydrolyze ATP and other nucleotides in the nervous system to regulate purinergic neurotransmission in the nervous system. May be implicated in inhibiting platelet aggregation by hydrolyzing platelet-activating ADP to AMP. Hydrolyzes ATP and ADP equally well. Belongs to the GDA1/CD39 NTPase family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.6.1.5; Extracellular matrix; Hydrolase; Membrane protein, integral; Membrane protein, multi-pass; Nucleotide Metabolism - purine; Nucleotide Metabolism - pyrimidine

Chromosomal Location of Human Ortholog: 10q24

Cellular Component: integral to plasma membrane; membrane

Molecular Function: protein binding

Biological Process: blood coagulation

Disease: Spastic Paraplegia 64, Autosomal Recessive

Research Articles on ENTPD1

Similar Products

Product Notes

The ENTPD1 entpd1 (Catalog #AAA1266656) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaagtg aagagttggc agacagggtt ctggatgtgg tggagaggag cctcagcaac tacccctttg acttccaggg tgccaggatc attactggcc aagaggaagg tgcctatggc tggattacta tcaactatct gctgggcaaa ttcagtcaga aaacaaggtg gttcagcata gtcccatatg aaaccaataa tcaggaaacc tttggagctt tggaccttgg gggagcctct acacaagtca cttttgtacc ccaaaaccag actatcgagt ccccagataa tgctctgcaa tttcgcctct atggcaagga ctacaatgtc tacacacata gcttcttgtg ctatgggaag gatcaggcac tctggcagaa actggccaag gacattcagg ttgcaagtaa tgaaattctc agggacccat gctttcatcc tggatataag aaggtagtga acgtaagtga cctttacaag accccctgca ccaagagatt tgagatgact cttccattcc agcagtttga aatccagggt attggaaact atcaacaatg ccatcaaagc atcctggagc tcttcaacac cagttactgc ccttactccc agtgtgcctt caatgggatt ttcttgccac cactccaggg ggattttggg gcattttcag ctttttactt tgtgatgaag tttttaaact tgacatcaga gaaagtctct caggaaaagg tgactgagat gatgaaaaag ttctgtgctc agccttggga ggagataaaa acatcttacg ctggagtaaa ggagaagtac ctgagtgaat actgcttttc tggtacctac attctctccc tccttctgca aggctatcat ttcacagctg attcctggga gcacatccat ttcattggca agatccaggg cagcgacgcc ggctggactt tgggctacat gctgaacctg accaacatga tcccagctga gcaaccattg tccacacctc tctcccactc cacctatgtc ttcctcatgg ttctattctc cctggtcctt ttcacagtgg ccatcatagg cttgcttatc tttcacaagc cttcatattt ctggaaagat atggtatag. It is sometimes possible for the material contained within the vial of "ENTPD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.