Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KAT5 cdna clone

KAT5 cDNA Clone

Gene Names
KAT5; TIP; ESA1; PLIP; TIP60; cPLA2; HTATIP; ZC2HC5; HTATIP1
Synonyms
KAT5; KAT5 cDNA Clone; KAT5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggaggtgggggagataatcgagggctgccgcctacccgtgctgcggcggaaccaggacaacgaagatgagtggcccctggccgagatcctgagcgtgaaggacatcagtggccggaagcttttctacgtccattacattgacttcaacaaacgtctggatgaatgggtgacgcatgagcggctggacctaaagaagatccagttccccaagaaagaggccaagacccccactaagaacggacttcctgggtcccgtcctggctctccagagagagaggtgccggcctcggcgcaggccagcgggaagaccttgccaatcccggtccagatcacactccgcttcaacctgcccaaggagcgggaggccattcccggtggcgagcctgaccagccgctctcctccagctcctgcctgcagcccaaccaccgctcaacgaaacggaaggtggaggtggtttcaccagcaactccagtgcccagcgagacagccccggcctcggtttttccccagaatggagccgcccgtagggcagtggcagcccagccaggacggaagcgaaaatcgaattgtttgggcactgatgaggactcccaggacagctctgatggaataccgtcagcaccacgcatgactggcagcctggtgtctgatcgaagccacgacgacatcgtcacccggatgaagaacattgagtgcattgagctgggccggcaccgcctcaagccgtggtacttctccccgtacccacaggaactcaccacattgcctgtcctctacctgtgcgagttctgcctcaagtacggccgtagtctcaagtgtcttcagcgtcatttgaccaagtgtgacctacgacatcctccaggcaatgagatttaccgcaagggcaccatctccttctttgagattgatggacgtaagaacaagagttattcccagaacctgtgtcttttggccaagtgtttccttgaccataagacactgtactatgacacagaccctttcctcttctacgtcatgacagagtatgactgtaagggcttccacatcgtgggctacttctccaaggagaaagaatcaacggaagactacaatgtggcctgcatcctaaccctgcctccctaccagcgccggggctacggcaagctgctgatcgagttcagctatgaactctccaaagtggaagggaaaacagggacccctgagaagcccctctcagaccttggcctcctatcctatcgaagctactggtcccagaccatcctggagatcctgatggggctgaagtcggagagcggggagaggccacagatcaccatcaatgagattagtgaaatcaccagcatcaagaaggaggatgtcatctccactctgcagtacctcaatctcatcaactactacaagggccagtacatcctcacactgtcagaggacatcgtggatggccatgagcgggccatgctcaagcggctcctgcggatcgactccaagtgtctgcacttcactcccaaggactggagcaagagggggaagtggtga
Sequence Length
1542
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,292 Da
NCBI Official Full Name
Homo sapiens K(lysine) acetyltransferase 5, mRNA
NCBI Official Synonym Full Names
lysine acetyltransferase 5
NCBI Official Symbol
KAT5
NCBI Official Synonym Symbols
TIP; ESA1; PLIP; TIP60; cPLA2; HTATIP; ZC2HC5; HTATIP1
NCBI Protein Information
histone acetyltransferase KAT5
UniProt Protein Name
Histone acetyltransferase KAT5
Protein Family
UniProt Gene Name
KAT5
UniProt Synonym Gene Names
HTATIP; TIP60; Tip60; HIV-1 Tat interactive protein
UniProt Entry Name
KAT5_HUMAN

NCBI Description

The protein encoded by this gene belongs to the MYST family of histone acetyl transferases (HATs) and was originally isolated as an HIV-1 TAT-interactive protein. HATs play important roles in regulating chromatin remodeling, transcription and other nuclear processes by acetylating histone and nonhistone proteins. This protein is a histone acetylase that has a role in DNA repair and apoptosis and is thought to play an important role in signal transduction. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]

Uniprot Description

Tip60: a histone acetyl transferase (HAT) of the MYST family. Originally isolated as an HIV-1 TAT-interactive protein. Plays an important role in regulating chromatin remodeling, transcription and other nuclear processes by acetylating nuclear proteins. Plays a role in DNA repair and apoptosis. Three splice variants have been described.

Protein type: Nuclear receptor co-regulator; Acetyltransferase; EC 2.3.1.48; Nucleolus

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: NuA4 histone acetyltransferase complex; nucleolus; nucleoplasm; nucleus

Molecular Function: acetyltransferase activity; histone acetyltransferase activity; protein binding; transcription coactivator activity

Biological Process: DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator; DNA double-strand break processing; DNA replication; DNA synthesis during DNA repair; double-strand break repair; double-strand break repair via nonhomologous end joining; histone acetylation; negative regulation of interleukin-2 production; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; proteasomal ubiquitin-dependent protein catabolic process; response to ionizing radiation; strand displacement

Research Articles on KAT5

Similar Products

Product Notes

The KAT5 kat5 (Catalog #AAA1266620) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagg tgggggagat aatcgagggc tgccgcctac ccgtgctgcg gcggaaccag gacaacgaag atgagtggcc cctggccgag atcctgagcg tgaaggacat cagtggccgg aagcttttct acgtccatta cattgacttc aacaaacgtc tggatgaatg ggtgacgcat gagcggctgg acctaaagaa gatccagttc cccaagaaag aggccaagac ccccactaag aacggacttc ctgggtcccg tcctggctct ccagagagag aggtgccggc ctcggcgcag gccagcggga agaccttgcc aatcccggtc cagatcacac tccgcttcaa cctgcccaag gagcgggagg ccattcccgg tggcgagcct gaccagccgc tctcctccag ctcctgcctg cagcccaacc accgctcaac gaaacggaag gtggaggtgg tttcaccagc aactccagtg cccagcgaga cagccccggc ctcggttttt ccccagaatg gagccgcccg tagggcagtg gcagcccagc caggacggaa gcgaaaatcg aattgtttgg gcactgatga ggactcccag gacagctctg atggaatacc gtcagcacca cgcatgactg gcagcctggt gtctgatcga agccacgacg acatcgtcac ccggatgaag aacattgagt gcattgagct gggccggcac cgcctcaagc cgtggtactt ctccccgtac ccacaggaac tcaccacatt gcctgtcctc tacctgtgcg agttctgcct caagtacggc cgtagtctca agtgtcttca gcgtcatttg accaagtgtg acctacgaca tcctccaggc aatgagattt accgcaaggg caccatctcc ttctttgaga ttgatggacg taagaacaag agttattccc agaacctgtg tcttttggcc aagtgtttcc ttgaccataa gacactgtac tatgacacag accctttcct cttctacgtc atgacagagt atgactgtaa gggcttccac atcgtgggct acttctccaa ggagaaagaa tcaacggaag actacaatgt ggcctgcatc ctaaccctgc ctccctacca gcgccggggc tacggcaagc tgctgatcga gttcagctat gaactctcca aagtggaagg gaaaacaggg acccctgaga agcccctctc agaccttggc ctcctatcct atcgaagcta ctggtcccag accatcctgg agatcctgat ggggctgaag tcggagagcg gggagaggcc acagatcacc atcaatgaga ttagtgaaat caccagcatc aagaaggagg atgtcatctc cactctgcag tacctcaatc tcatcaacta ctacaagggc cagtacatcc tcacactgtc agaggacatc gtggatggcc atgagcgggc catgctcaag cggctcctgc ggatcgactc caagtgtctg cacttcactc ccaaggactg gagcaagagg gggaagtggt ga. It is sometimes possible for the material contained within the vial of "KAT5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.