PARS2 cdna clone
PARS2 cDNA Clone
Gene Names
PARS2; proRS; MT-PRORS
Synonyms
PARS2; PARS2 cDNA Clone; PARS2 cdna clone
Sequence
atggaagggctgctgacaagatgcagagcattgcccgccctggccacctgcagccgccagctctctgggtatgttccttgcaggtttcaccactgtgccccaagaagagggcggcgcctgctgctgtctcgtgtgttccagccacagaaccttcgggaagaccgggtgctctccctgcaggacaaatctgatgacctgacctgtaagagccagcggctgatgctgcaggtgggcctgatctacccagcaagccccggctgttaccacctcctgccatataccgtccgtgccatggagaagctcgtgcgagtgatagaccaggagatgcaggccatcgggggccagaaagtcaacatgcccagcctcagcccggcagagctctggcaagccaccaaccggtgggacttgatgggcaaagagctgctaagacttagagacaggcatggcaaggaatactgcttaggaccaactcacgaggaagccattacggccttaattgcctcccagaagaaactgtcctacaagcagcttcccttcctgctgtaccaagtgacaaggaagtttcgggatgagcccaggccccgctttggtcttctccgtggccgagagttttacatgaaggatatgtacacctttgactcctccccagaggctgcccagcagacctacagcctggtgtgtgatgcctactgcagcctgttcaacaagctagggctgccatttgtcaaggtccaggccgatgtgggcaccatcgggggcacagtgtctcatgagttccagctcccagtggatattggagaggaccggcttgccatctgtccccgctgcagcttctcagccaacatggagacactagacttgtcacaaatgaactgccctgcttgccagggcccattgactaaaaccaaaggcattgaggtggggcacacattttacctgggtaccaagtactcatccattttcaatgcccagtttaccaatgtctgtggcaaaccaaccctggctgaaatggggtgctatggcttgggtgtgacacggatcttggctgctgccattgaagtcctctctacagaagactgtgtccgctggcccagcctactggccccttaccaagcctgcctcatcccccctaagaagggcagtaaggagcaggcggcctccgagctcatagggcagctgtacgaccacatcacagaggcagtgcctcagcttcacggggaggtgctcctggacgacaggacccatctgaccatcggaaacagactgaaagatgccaacaagtttggctacccctttgtgataatcgctggcaagagggccctggaggaccctgcacattttgaggtttggtgtcagaacactggtgaggtggccttcctcaccaaagatggagtcatggatttactgaccccagtgcagactgtctaa
Sequence Length
1428
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
53,263 Da
NCBI Official Full Name
Homo sapiens prolyl-tRNA synthetase 2, mitochondrial (putative), mRNA
NCBI Official Synonym Full Names
prolyl-tRNA synthetase 2, mitochondrial (putative)
NCBI Official Symbol
PARS2
NCBI Official Synonym Symbols
proRS; MT-PRORS
NCBI Protein Information
probable proline--tRNA ligase, mitochondrial
UniProt Protein Name
Probable proline--tRNA ligase, mitochondrial
UniProt Gene Name
PARS2
UniProt Synonym Gene Names
ProRS
UniProt Entry Name
SYPM_HUMAN
NCBI Description
This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of proline to tRNA molecules. Mutations have been found in this gene in some patients with Alpers syndrome. [provided by RefSeq, Mar 2015]
Uniprot Description
PARS2: Belongs to the class-II aminoacyl-tRNA synthetase family.
Protein type: Ligase; Mitochondrial; EC 6.1.1.15
Chromosomal Location of Human Ortholog: 1p32.2
Cellular Component: mitochondrion
Molecular Function: proline-tRNA ligase activity; RNA binding
Biological Process: prolyl-tRNA aminoacylation
Research Articles on PARS2
Similar Products
Product Notes
The PARS2 pars2 (Catalog #AAA1266553) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagggc tgctgacaag atgcagagca ttgcccgccc tggccacctg cagccgccag ctctctgggt atgttccttg caggtttcac cactgtgccc caagaagagg gcggcgcctg ctgctgtctc gtgtgttcca gccacagaac cttcgggaag accgggtgct ctccctgcag gacaaatctg atgacctgac ctgtaagagc cagcggctga tgctgcaggt gggcctgatc tacccagcaa gccccggctg ttaccacctc ctgccatata ccgtccgtgc catggagaag ctcgtgcgag tgatagacca ggagatgcag gccatcgggg gccagaaagt caacatgccc agcctcagcc cggcagagct ctggcaagcc accaaccggt gggacttgat gggcaaagag ctgctaagac ttagagacag gcatggcaag gaatactgct taggaccaac tcacgaggaa gccattacgg ccttaattgc ctcccagaag aaactgtcct acaagcagct tcccttcctg ctgtaccaag tgacaaggaa gtttcgggat gagcccaggc cccgctttgg tcttctccgt ggccgagagt tttacatgaa ggatatgtac acctttgact cctccccaga ggctgcccag cagacctaca gcctggtgtg tgatgcctac tgcagcctgt tcaacaagct agggctgcca tttgtcaagg tccaggccga tgtgggcacc atcgggggca cagtgtctca tgagttccag ctcccagtgg atattggaga ggaccggctt gccatctgtc cccgctgcag cttctcagcc aacatggaga cactagactt gtcacaaatg aactgccctg cttgccaggg cccattgact aaaaccaaag gcattgaggt ggggcacaca ttttacctgg gtaccaagta ctcatccatt ttcaatgccc agtttaccaa tgtctgtggc aaaccaaccc tggctgaaat ggggtgctat ggcttgggtg tgacacggat cttggctgct gccattgaag tcctctctac agaagactgt gtccgctggc ccagcctact ggccccttac caagcctgcc tcatcccccc taagaagggc agtaaggagc aggcggcctc cgagctcata gggcagctgt acgaccacat cacagaggca gtgcctcagc ttcacgggga ggtgctcctg gacgacagga cccatctgac catcggaaac agactgaaag atgccaacaa gtttggctac ccctttgtga taatcgctgg caagagggcc ctggaggacc ctgcacattt tgaggtttgg tgtcagaaca ctggtgaggt ggccttcctc accaaagatg gagtcatgga tttactgacc ccagtgcaga ctgtctaa. It is sometimes possible for the material contained within the vial of "PARS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
