Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FGFRL1 cdna clone

FGFRL1 cDNA Clone

Gene Names
FGFRL1; FHFR; FGFR5
Synonyms
FGFRL1; FGFRL1 cDNA Clone; FGFRL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggcgccgggtgatcgcacggcccgtgggtagctccgtgcggctcaagtgcgtggccagcgggcaccctcggcccgacatcacgtggatgaaggacgaccaggccttgacgcgcccagaggccgctgagcccaggaagaagaagtggacactgagcctgaagaacctgcggccggaggacagcggcaaatacacctgccgcgtgtcgaaccgcgcgggcgccatcaacgccacctacaaggtggatgtgatccagcggacccgttccaagcccgtgctcacaggcacgcaccccgtgaacacgacggtggacttcggggggaccacgtccttccagtgcaaggtgcgcagcgacgtgaagccggtgatccagtggctgaagcgcgtggagtacggcgccgagggccgccacaactccaccatcgatgtgggcggccagaagtttgtggtgctgcccacgggtgacgtgtggtcgcggcccgacggctcctacctcaataagctgctcatcacccgtgcccgccaggacgatgcgggcatgtacatctgccttggcgccaacaccatgggctacagcttccgcagcgccttcctcaccgtgctgccagacccaaaaccgcaagggccacctgtggcctcctcgtcctcggccactagcctgccgtggcccgtggtcatcggcatcccagccggcgctgtcttcatcctgggcaccctgctcctgtggctttgccaggcccagaagaagccgtgcacccccgcgcctgcccctcccctgcctgggcaccgcccgccggggacggcccgcgaccgcagcggagacaaggaccttccctcgttggccgccctcagcgctggccctggtgtggggctgtgtgaggagcatgggtctccggcagccccccagcacttactgggcccaggcccagttgctggccctaagttgtaccccaaactctacacagacatccacacacacacacacacacactctcacacacactcacacgtggagggcaaggtccaccagcacatccactatcagtgctag
Sequence Length
1053
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,537 Da
NCBI Official Full Name
Homo sapiens fibroblast growth factor receptor-like 1, mRNA
NCBI Official Synonym Full Names
fibroblast growth factor receptor-like 1
NCBI Official Symbol
FGFRL1
NCBI Official Synonym Symbols
FHFR; FGFR5
NCBI Protein Information
fibroblast growth factor receptor-like 1
UniProt Protein Name
Fibroblast growth factor receptor-like 1
UniProt Gene Name
FGFRL1
UniProt Synonym Gene Names
FGFR5; FHFR; FGF receptor-like protein 1; FGFR-5
UniProt Entry Name
FGRL1_HUMAN

NCBI Description

The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

FGFRL1: Has a negative effect on cell proliferation.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 4p16

Cellular Component: Golgi apparatus; plasma membrane; transport vesicle

Molecular Function: fibroblast growth factor receptor activity; heparin binding

Biological Process: fibroblast growth factor receptor signaling pathway; protein heterooligomerization; protein homooligomerization

Disease: Wolf-hirschhorn Syndrome

Research Articles on FGFRL1

Similar Products

Product Notes

The FGFRL1 fgfrl1 (Catalog #AAA1266527) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggcgcc gggtgatcgc acggcccgtg ggtagctccg tgcggctcaa gtgcgtggcc agcgggcacc ctcggcccga catcacgtgg atgaaggacg accaggcctt gacgcgccca gaggccgctg agcccaggaa gaagaagtgg acactgagcc tgaagaacct gcggccggag gacagcggca aatacacctg ccgcgtgtcg aaccgcgcgg gcgccatcaa cgccacctac aaggtggatg tgatccagcg gacccgttcc aagcccgtgc tcacaggcac gcaccccgtg aacacgacgg tggacttcgg ggggaccacg tccttccagt gcaaggtgcg cagcgacgtg aagccggtga tccagtggct gaagcgcgtg gagtacggcg ccgagggccg ccacaactcc accatcgatg tgggcggcca gaagtttgtg gtgctgccca cgggtgacgt gtggtcgcgg cccgacggct cctacctcaa taagctgctc atcacccgtg cccgccagga cgatgcgggc atgtacatct gccttggcgc caacaccatg ggctacagct tccgcagcgc cttcctcacc gtgctgccag acccaaaacc gcaagggcca cctgtggcct cctcgtcctc ggccactagc ctgccgtggc ccgtggtcat cggcatccca gccggcgctg tcttcatcct gggcaccctg ctcctgtggc tttgccaggc ccagaagaag ccgtgcaccc ccgcgcctgc ccctcccctg cctgggcacc gcccgccggg gacggcccgc gaccgcagcg gagacaagga ccttccctcg ttggccgccc tcagcgctgg ccctggtgtg gggctgtgtg aggagcatgg gtctccggca gccccccagc acttactggg cccaggccca gttgctggcc ctaagttgta ccccaaactc tacacagaca tccacacaca cacacacaca cactctcaca cacactcaca cgtggagggc aaggtccacc agcacatcca ctatcagtgc tag. It is sometimes possible for the material contained within the vial of "FGFRL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.