Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCL4 cdna clone

CCL4 cDNA Clone

Gene Names
CCL4; ACT2; G-26; HC21; LAG1; LAG-1; MIP1B; SCYA2; SCYA4; MIP1B1; AT744.1; MIP-1-beta
Synonyms
CCL4; CCL4 cDNA Clone; CCL4 cdna clone
Ordering
For Research Use Only!
Sequence
ATGAAGCTCTGCGTGACTGTCCTGTCTCTCCTCATGCTAGTAGCTGCCTTCTGCTCTCCAGCGCTCTCAGCACCAATGGGCTCAGACCCTCCCACCGCCTGCTGCTTTTCTTACACCGCGAGGAAGCTTCCTCGCAACTTTGTGGTAGATTACTATGAGACCAGCAGCCTCTGCTCCCAGCCAGCTGTGGTATTCCAAACCAAAAGAAGCAAGCAAGTCTGTGCTGATCCCAGTGAGACCTGGGTCCAGGAGTACGTGTATGACCTGGAACTGAACTGA
Sequence Length
279
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,212 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) ligand 4, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine ligand 4
NCBI Official Symbol
CCL4
NCBI Official Synonym Symbols
ACT2; G-26; HC21; LAG1; LAG-1; MIP1B; SCYA2; SCYA4; MIP1B1; AT744.1; MIP-1-beta
NCBI Protein Information
C-C motif chemokine 4
UniProt Protein Name
C-C motif chemokine 4
Protein Family
UniProt Gene Name
CCL4
UniProt Synonym Gene Names
LAG1; MIP1B; SCYA4; LAG-1; MIP-1-beta; ACT-2
UniProt Entry Name
CCL4_HUMAN

NCBI Description

The protein encoded by this gene is a mitogen-inducible monokine and is one of the major HIV-suppressive factors produced by CD8+ T-cells. The encoded protein is secreted and has chemokinetic and inflammatory functions. [provided by RefSeq, Dec 2012]

Uniprot Description

CCL4: Monokine with inflammatory and chemokinetic properties. Binds to CCR5. One of the major HIV-suppressive factors produced by CD8+ T-cells. Recombinant MIP-1-beta induces a dose-dependent inhibition of different strains of HIV-1, HIV-2, and simian immunodeficiency virus (SIV). The processed form MIP-1-beta(3-69) retains the abilities to induce down-modulation of surface expression of the chemokine receptor CCR5 and to inhibit the CCR5- mediated entry of HIV-1 in T-cells. MIP-1-beta(3-69) is also a ligand for CCR1 and CCR2 isoform B. Belongs to the intercrine beta (chemokine CC) family.

Protein type: Secreted; Chemokine; Motility/polarity/chemotaxis; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 17q12

Cellular Component: extracellular region

Molecular Function: CCR1 chemokine receptor binding; CCR5 chemokine receptor binding; cytokine activity; identical protein binding; protein binding

Biological Process: cell adhesion; cell motility; cell-cell signaling; establishment and/or maintenance of cell polarity; G-protein coupled receptor protein signaling pathway; immune response; monocyte chemotaxis; neutrophil chemotaxis; positive regulation of calcium ion transport; positive regulation of calcium-mediated signaling; positive regulation of GTPase activity; positive regulation of inflammatory response; response to toxin; response to virus; signal transduction

Research Articles on CCL4

Similar Products

Product Notes

The CCL4 ccl4 (Catalog #AAA1266485) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAAGCTCT GCGTGACTGT CCTGTCTCTC CTCATGCTAG TAGCTGCCTT CTGCTCTCCA GCGCTCTCAG CACCAATGGG CTCAGACCCT CCCACCGCCT GCTGCTTTTC TTACACCGCG AGGAAGCTTC CTCGCAACTT TGTGGTAGAT TACTATGAGA CCAGCAGCCT CTGCTCCCAG CCAGCTGTGG TATTCCAAAC CAAAAGAAGC AAGCAAGTCT GTGCTGATCC CAGTGAGACC TGGGTCCAGG AGTACGTGTA TGACCTGGAA CTGAACTGA. It is sometimes possible for the material contained within the vial of "CCL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.