Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF367 cdna clone

ZNF367 cDNA Clone

Gene Names
ZNF367; AFF29; ZFF29; CDC14B
Synonyms
ZNF367; ZNF367 cDNA Clone; ZNF367 cdna clone
Ordering
For Research Use Only!
Sequence
atgatccggggcttcgaggcgcccatggcggagaacccgccgccgccgccgccgcccgtcatcttctgccacgactccccgaagcgggtgctggtgtcggtcatcaggacgaccccgatcaagccaacgtgcggcggtggaggggagccggagccgccgccgccgctcatccccaccagccccggcttcagcgacttcatggtgtacccgtggcgctggggcgagaacgcacacaacgtgacgctcagccctggggccgcgggggccgccgcctcggccgccctgcctgcagccgcagccgccgagcactcggggcttcgtggccggggcgcgcccccgcccgccgcctcggcctccgccgccgcctcgggaggtgaggacgaggaggaagcgagcagcccagacagcggccacctcaaggatggaatccgacgtggtaggcccagagcagatactgtccgcgatttaataaatgaaggagagcattcatccagcagaatccgttgtaacatctgtaatagggtgtttccacgggagaaatcgctccaggctcacaaaaggactcatacaggtgagaggccctatctgtgtgactatccagactgtggaaaagcctttgttcaaagtggacagctcaaaacacatcagcgtcttcacaccggagagaaaccttttgtttgttcagaaaatggctgcctgagcagattcacccatgcaaaccgccactgtccgaagcacccctacgccaggctgaagagagaggagcccacggacacactcagcaaacatcaggctgccgacaacaaggccgcggccgagtggctggcgaggtattgggaaatgagagagcagcgcacccccactttgaaaggcaagctggttcagaaggctgatcaggagcagcaggaccctctggaataccttcagtctgatgaagaggacgacgagaagagaggggcccagcgccggctgcaggagcagcgggagcgcctgcatggagccctcgcgctcatagagcttgccaacctgactggggcgccactccgacagtag
Sequence Length
1053
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,894 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 367, mRNA
NCBI Official Synonym Full Names
zinc finger protein 367
NCBI Official Symbol
ZNF367
NCBI Official Synonym Symbols
AFF29; ZFF29; CDC14B
NCBI Protein Information
zinc finger protein 367
UniProt Protein Name
Zinc finger protein 367
Protein Family
UniProt Gene Name
ZNF367
UniProt Synonym Gene Names
ZFF29
UniProt Entry Name
ZN367_HUMAN

Uniprot Description

ZNF367: Transcriptional activator. Isoform 1 may be involved in transcriptional activation of erythroid genes. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; C2H2-type zinc finger protein; Transcription factor

Chromosomal Location of Human Ortholog: 9q22|9q22.32

Cellular Component: nucleoplasm; nucleus

Molecular Function: transcription factor activity

Biological Process: regulation of transcription from RNA polymerase II promoter

Research Articles on ZNF367

Similar Products

Product Notes

The ZNF367 znf367 (Catalog #AAA1266357) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatccggg gcttcgaggc gcccatggcg gagaacccgc cgccgccgcc gccgcccgtc atcttctgcc acgactcccc gaagcgggtg ctggtgtcgg tcatcaggac gaccccgatc aagccaacgt gcggcggtgg aggggagccg gagccgccgc cgccgctcat ccccaccagc cccggcttca gcgacttcat ggtgtacccg tggcgctggg gcgagaacgc acacaacgtg acgctcagcc ctggggccgc gggggccgcc gcctcggccg ccctgcctgc agccgcagcc gccgagcact cggggcttcg tggccggggc gcgcccccgc ccgccgcctc ggcctccgcc gccgcctcgg gaggtgagga cgaggaggaa gcgagcagcc cagacagcgg ccacctcaag gatggaatcc gacgtggtag gcccagagca gatactgtcc gcgatttaat aaatgaagga gagcattcat ccagcagaat ccgttgtaac atctgtaata gggtgtttcc acgggagaaa tcgctccagg ctcacaaaag gactcataca ggtgagaggc cctatctgtg tgactatcca gactgtggaa aagcctttgt tcaaagtgga cagctcaaaa cacatcagcg tcttcacacc ggagagaaac cttttgtttg ttcagaaaat ggctgcctga gcagattcac ccatgcaaac cgccactgtc cgaagcaccc ctacgccagg ctgaagagag aggagcccac ggacacactc agcaaacatc aggctgccga caacaaggcc gcggccgagt ggctggcgag gtattgggaa atgagagagc agcgcacccc cactttgaaa ggcaagctgg ttcagaaggc tgatcaggag cagcaggacc ctctggaata ccttcagtct gatgaagagg acgacgagaa gagaggggcc cagcgccggc tgcaggagca gcgggagcgc ctgcatggag ccctcgcgct catagagctt gccaacctga ctggggcgcc actccgacag tag. It is sometimes possible for the material contained within the vial of "ZNF367, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.