Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACOT2 cdna clone

ACOT2 cDNA Clone

Gene Names
ACOT2; MTE1; PTE2; CTE1A; PTE2A; CTE-IA; ZAP128
Synonyms
ACOT2; ACOT2 cDNA Clone; ACOT2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgacgctgatcctggagcctgcgggccgctgctgctgggacgaaccggtgcgaatcgccgtgcgcggcctagccccggagcagccggtcacgctgcgcgcgtccctgcgcgacgagaagggcgcgcttttccaggcccacgcgcgctaccgcgccgacactcttggcgagctggacctggagcgcgcgcccgcgctgggcggcagcttcgcggggcttgagcccatggggctgctctgggccttggagcccgagaaacctttggtgcggctggtgaagcgcgacgtgcgaacgcccttggccgtggagctggaggtgctggatggccacgaccccgaccccgggcggctgctgtgccagacgcggcacgagcgctacttcctcccgcccggggtgcggcgcgagccggtgcgcgtgggccgggtgcgaggcacgctcttcctgccgccagaacctgggccctttcctgggattgtggacatgttcggaactggaggtggcctgctggagtatcgggctagtctgctggctgggaagggttttgctgtgatggctctggcttattataactatgaagacctccccaagaccatggagacgctccatctggagtactttgaagaagccatgaactacttgctcagtcatcccgaggtaaaaggtccaggagttgggctgcttggaatttccaaagggggtgagctctgcctttccatggcctctttcctgaagggcatcacggctgctgtcgtcatcaacggctctgtggccaatgttgggggaaccttacgctacaagggcgagaccctgccccctgtgggcgtcaacagaaatcgcatcaaggtgaccaaagatggctatgcagacattgtggatgtcctgaacagccctttggaaggacctgaccagaagagcttcattcctgtggaaagggcagagagcaccttcctgttcctggtaggtcaggatgaccacaactggaagagtgagttctatgctaatgaggcctgtaaacgcttgcaggcccatgggaggagaaagccccagatcatctgttacccagagacagggcactatattgagcctccttacttccccctgtgtcgggcttccctgcatgccttggtgggcagtcctattatctggggaggggagcccagggctcatgccatggctcaggtggatgcttggaaacaactccagactttcttccacaaacacttgggtggccgcgaggggacaatcccatcaaaagtgtaa
Sequence Length
1266
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,959 Da
NCBI Official Full Name
Homo sapiens acyl-CoA thioesterase 2, mRNA
NCBI Official Synonym Full Names
acyl-CoA thioesterase 2
NCBI Official Symbol
ACOT2
NCBI Official Synonym Symbols
MTE1; PTE2; CTE1A; PTE2A; CTE-IA; ZAP128
NCBI Protein Information
acyl-coenzyme A thioesterase 2, mitochondrial
UniProt Protein Name
Acyl-coenzyme A thioesterase 2, mitochondrial
UniProt Gene Name
ACOT2
UniProt Synonym Gene Names
PTE2; PTE2A; Acyl-CoA thioesterase 2
UniProt Entry Name
ACOT2_HUMAN

NCBI Description

This gene encodes a member of the acyl-CoA thioesterase protein family, and is one of four acyl-CoA hydrolase genes located in a cluster on chromosome 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]

Uniprot Description

ACOT2: Acyl-CoA thioesterases are a group of enzymes that catalyze the hydrolysis of acyl-CoAs to the free fatty acid and coenzyme A (CoASH), providing the potential to regulate intracellular levels of acyl-CoAs, free fatty acids and CoASH. Displays high levels of activity on medium- and long chain acyl CoAs. Belongs to the C/M/P thioester hydrolase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.1.2.2; Mitochondrial; Hydrolase; Lipid Metabolism - unsaturated fatty acid biosynthesis

Chromosomal Location of Human Ortholog: 14q24.3

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: acyl-CoA hydrolase activity; receptor binding

Biological Process: acyl-CoA metabolic process; long-chain fatty acid metabolic process; very-long-chain fatty acid metabolic process

Research Articles on ACOT2

Similar Products

Product Notes

The ACOT2 acot2 (Catalog #AAA1266348) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcga cgctgatcct ggagcctgcg ggccgctgct gctgggacga accggtgcga atcgccgtgc gcggcctagc cccggagcag ccggtcacgc tgcgcgcgtc cctgcgcgac gagaagggcg cgcttttcca ggcccacgcg cgctaccgcg ccgacactct tggcgagctg gacctggagc gcgcgcccgc gctgggcggc agcttcgcgg ggcttgagcc catggggctg ctctgggcct tggagcccga gaaacctttg gtgcggctgg tgaagcgcga cgtgcgaacg cccttggccg tggagctgga ggtgctggat ggccacgacc ccgaccccgg gcggctgctg tgccagacgc ggcacgagcg ctacttcctc ccgcccgggg tgcggcgcga gccggtgcgc gtgggccggg tgcgaggcac gctcttcctg ccgccagaac ctgggccctt tcctgggatt gtggacatgt tcggaactgg aggtggcctg ctggagtatc gggctagtct gctggctggg aagggttttg ctgtgatggc tctggcttat tataactatg aagacctccc caagaccatg gagacgctcc atctggagta ctttgaagaa gccatgaact acttgctcag tcatcccgag gtaaaaggtc caggagttgg gctgcttgga atttccaaag ggggtgagct ctgcctttcc atggcctctt tcctgaaggg catcacggct gctgtcgtca tcaacggctc tgtggccaat gttgggggaa ccttacgcta caagggcgag accctgcccc ctgtgggcgt caacagaaat cgcatcaagg tgaccaaaga tggctatgca gacattgtgg atgtcctgaa cagccctttg gaaggacctg accagaagag cttcattcct gtggaaaggg cagagagcac cttcctgttc ctggtaggtc aggatgacca caactggaag agtgagttct atgctaatga ggcctgtaaa cgcttgcagg cccatgggag gagaaagccc cagatcatct gttacccaga gacagggcac tatattgagc ctccttactt ccccctgtgt cgggcttccc tgcatgcctt ggtgggcagt cctattatct ggggagggga gcccagggct catgccatgg ctcaggtgga tgcttggaaa caactccaga ctttcttcca caaacacttg ggtggccgcg aggggacaat cccatcaaaa gtgtaa. It is sometimes possible for the material contained within the vial of "ACOT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.