Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF11 cdna clone

RNF11 cDNA Clone

Gene Names
RNF11; CGI-123; SID1669
Synonyms
RNF11; RNF11 cDNA Clone; RNF11 cdna clone
Ordering
For Research Use Only!
Sequence
atggggaactgcctcaaatcccccacctcggatgacatctccctgcttcacgagtctcagtccgaccgggctagctttggcgaggggacggagccggatcaggagccgccgccgccatatcaggaacaagttccagttccagtctaccacccaacacctagccagactcggctagcaactcagctgactgaagaggaacaaattaggatagctcaaagaataggtcttatacaacatctgcctaaaggagtttatgaccctggaagagatggatcagaaaaaaagatccgggagtgtgtgatctgtatgatggactttgtttatggggacccaattcgatttctgccgtgcatgcacatctatcacctggactgtatagatgactggttgatgagatccttcacgtgcccctcctgcatggagccagttgatgcagcactgctttcatcctatgagactaattga
Sequence Length
465
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,444 Da
NCBI Official Full Name
Homo sapiens ring finger protein 11, mRNA
NCBI Official Synonym Full Names
ring finger protein 11
NCBI Official Symbol
RNF11
NCBI Official Synonym Symbols
CGI-123; SID1669
NCBI Protein Information
RING finger protein 11
UniProt Protein Name
RING finger protein 11
Protein Family
UniProt Gene Name
RNF11
UniProt Entry Name
RNF11_HUMAN

NCBI Description

The protein encoded by this gene contains a RING-H2 finger motif, which is known to be important for protein-protein interactions. The expression of this gene has been shown to be induced by mutant RET proteins (MEN2A/MEN2B). The germline mutations in RET gene are known to be responsible for the development of multiple endocrine neoplasia (MEN). [provided by RefSeq, Jul 2008]

Uniprot Description

RNF11: Essential component of a ubiquitin-editing protein complex, comprising also TNFAIP3, ITCH and TAX1BP1, that ensures the transient nature of inflammatory signaling pathways. Promotes the association of TNFAIP3 to RIPK1 after TNF stimulation. TNFAIP3 deubiquitinates 'Lys-63' polyubiquitin chains on RIPK1 and catalyzes the formation of 'Lys-48'-polyubiquitin chains. This leads to RIPK1 proteasomal degradation and consequently termination of the TNF- or LPS-mediated activation of NF-kappa-B. Recruits STAMBP to the E3 ubiquitin-ligase SMURF2 for ubiquitination, leading to its degradation by the 26S proteasome.

Protein type: Ubiquitin ligase; EC 6.3.2.-; Ubiquitin conjugating system; Ligase

Chromosomal Location of Human Ortholog: 1p32

Cellular Component: ubiquitin ligase complex

Molecular Function: DNA binding; protein binding; ubiquitin-protein ligase activity

Biological Process: protein autoubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process

Research Articles on RNF11

Similar Products

Product Notes

The RNF11 rnf11 (Catalog #AAA1266324) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaact gcctcaaatc ccccacctcg gatgacatct ccctgcttca cgagtctcag tccgaccggg ctagctttgg cgaggggacg gagccggatc aggagccgcc gccgccatat caggaacaag ttccagttcc agtctaccac ccaacaccta gccagactcg gctagcaact cagctgactg aagaggaaca aattaggata gctcaaagaa taggtcttat acaacatctg cctaaaggag tttatgaccc tggaagagat ggatcagaaa aaaagatccg ggagtgtgtg atctgtatga tggactttgt ttatggggac ccaattcgat ttctgccgtg catgcacatc tatcacctgg actgtataga tgactggttg atgagatcct tcacgtgccc ctcctgcatg gagccagttg atgcagcact gctttcatcc tatgagacta attga. It is sometimes possible for the material contained within the vial of "RNF11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.