Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

INPP5K cdna clone

INPP5K cDNA Clone

Gene Names
INPP5K; PPS; SKIP
Synonyms
INPP5K; INPP5K cDNA Clone; INPP5K cdna clone
Ordering
For Research Use Only!
Sequence
atgagctcgcggaagctgagcgggccgaaaggcaggaggctcagcatacacgtcgtgacttggaacgtggcttcggcagcgccccctctagatctcagtgacctgcttcagctgaacaaccggaacctcaatcttgacatatatgttattggtttgcaggaattgaactctgggatcataagcctcctttccgatgctgcctttaatgactcgtggagcagtttcctcatggatgtgctttcccctctgagcttcatcaaggtctcccatgtccgtatgcaggggatcctcttactggtctttgccaagtatcagcatttgccctatatccagattctgtctactaaatccacccccactggcctgtttgggtactgggggaacaaaggtggagtcaacatctgcctgaagctttatggctactatgtcagcatcatcaactgccacctgcctccccacatttccaacaattaccagcggctggagcactttgaccggatcctggagatgcagaattgtgaggggcgagacatcccaaacatcctggaccacgacctcattatctggtttggagacatgaactttcggatcgaggactttgggttgcactttgttcgggaatccattaaaaatcggtgctacggtggcctgtgggagaaggaccagctcagcattgccaagaaacatgacccgctgctccgggagttccaggagggccgcctactcttcccgcccacctacaagtttgataggaactccaacgactatgacaccagtgagaaaaaacgcaagcctgcatggaccgatcgcatcctgtggaggctgaagcggcagccctgtgctggccccgacactcccataccgccggcgtcacacttctccttgtctctgaggggctacagcagccacatgacgtacggcatcagcgaccacaagcctgtctccggcacgttcgacttggagctgaagccattggtgtctgctccgctgatcgtcctgatgcccgaggacctgtggaccgtggaaaatgacatgatggtcagctactcttcaacctcggacttccccagcagcccgtgggactggattggactgtacaaggtggggctgcgggacgttaatgactacgtgtcctatgcctgggtcggggacagcaaggtctcctgcagcgacaacctgaaccaggtttacatcgacatcagcaatatccctaccactgaagatgagtttctcctctgttactacagcaacagtctgcgttctgtggtggggataagcagacccttccagatcccgcctggctccttgagggaggacccactgggtgaagcacagccacagatctga
Sequence Length
1347
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,784 Da
NCBI Official Full Name
Homo sapiens inositol polyphosphate-5-phosphatase K, mRNA
NCBI Official Synonym Full Names
inositol polyphosphate-5-phosphatase K
NCBI Official Symbol
INPP5K
NCBI Official Synonym Symbols
PPS; SKIP
NCBI Protein Information
inositol polyphosphate 5-phosphatase K
UniProt Protein Name
Inositol polyphosphate 5-phosphatase K
UniProt Gene Name
INPP5K
UniProt Synonym Gene Names
PPS; SKIP
UniProt Entry Name
INP5K_HUMAN

NCBI Description

This gene encodes a protein with 5-phosphatase activity toward polyphosphate inositol. The protein localizes to the cytosol in regions lacking actin stress fibers. It is thought that this protein may negatively regulate the actin cytoskeleton. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]

Uniprot Description

INPP5K: Inositol 5-phosphatase which acts on inositol 1,4,5- trisphosphate, inositol 1,3,4,5-tetrakisphosphate, phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Has 6-fold higher affinity for phosphatidylinositol 4,5-bisphosphate than for inositol 1,4,5- trisphosphate. May negatively regulate assembly of the actin cytoskeleton. Belongs to the inositol 1,4,5-trisphosphate 5- phosphatase type II family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.1.3.56; Phosphatase (non-protein); Carbohydrate Metabolism - inositol phosphate

Chromosomal Location of Human Ortholog: 17p13.3

Cellular Component: cytoplasm; cytosol; endoplasmic reticulum; membrane; neuron projection; nucleus; perinuclear region of cytoplasm; plasma membrane; ruffle; trans-Golgi network

Molecular Function: inositol bisphosphate phosphatase activity; inositol trisphosphate phosphatase activity; phosphoinositide 5-phosphatase activity; protein binding; vasopressin receptor activity

Biological Process: cellular response to hormone stimulus; cellular response to insulin stimulus; dephosphorylation; G-protein coupled receptor protein signaling pathway; glucose homeostasis; inositol phosphate dephosphorylation; negative regulation of calcium ion transport; negative regulation of dephosphorylation; negative regulation of glycogen biosynthetic process; negative regulation of insulin receptor signaling pathway; negative regulation of MAP kinase activity; negative regulation of peptidyl-serine phosphorylation; negative regulation of protein amino acid phosphorylation; negative regulation of protein kinase activity; negative regulation of protein kinase B signaling cascade; negative regulation of retroviral genome replication; negative regulation of stress fiber formation; negative regulation of transcription, DNA-dependent; phosphatidylinositol biosynthetic process; phosphoinositide dephosphorylation; positive regulation of transcription, DNA-dependent; regulation of glycogen biosynthetic process

Research Articles on INPP5K

Similar Products

Product Notes

The INPP5K inpp5k (Catalog #AAA1266319) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctcgc ggaagctgag cgggccgaaa ggcaggaggc tcagcataca cgtcgtgact tggaacgtgg cttcggcagc gccccctcta gatctcagtg acctgcttca gctgaacaac cggaacctca atcttgacat atatgttatt ggtttgcagg aattgaactc tgggatcata agcctccttt ccgatgctgc ctttaatgac tcgtggagca gtttcctcat ggatgtgctt tcccctctga gcttcatcaa ggtctcccat gtccgtatgc aggggatcct cttactggtc tttgccaagt atcagcattt gccctatatc cagattctgt ctactaaatc cacccccact ggcctgtttg ggtactgggg gaacaaaggt ggagtcaaca tctgcctgaa gctttatggc tactatgtca gcatcatcaa ctgccacctg cctccccaca tttccaacaa ttaccagcgg ctggagcact ttgaccggat cctggagatg cagaattgtg aggggcgaga catcccaaac atcctggacc acgacctcat tatctggttt ggagacatga actttcggat cgaggacttt gggttgcact ttgttcggga atccattaaa aatcggtgct acggtggcct gtgggagaag gaccagctca gcattgccaa gaaacatgac ccgctgctcc gggagttcca ggagggccgc ctactcttcc cgcccaccta caagtttgat aggaactcca acgactatga caccagtgag aaaaaacgca agcctgcatg gaccgatcgc atcctgtgga ggctgaagcg gcagccctgt gctggccccg acactcccat accgccggcg tcacacttct ccttgtctct gaggggctac agcagccaca tgacgtacgg catcagcgac cacaagcctg tctccggcac gttcgacttg gagctgaagc cattggtgtc tgctccgctg atcgtcctga tgcccgagga cctgtggacc gtggaaaatg acatgatggt cagctactct tcaacctcgg acttccccag cagcccgtgg gactggattg gactgtacaa ggtggggctg cgggacgtta atgactacgt gtcctatgcc tgggtcgggg acagcaaggt ctcctgcagc gacaacctga accaggttta catcgacatc agcaatatcc ctaccactga agatgagttt ctcctctgtt actacagcaa cagtctgcgt tctgtggtgg ggataagcag acccttccag atcccgcctg gctccttgag ggaggaccca ctgggtgaag cacagccaca gatctga. It is sometimes possible for the material contained within the vial of "INPP5K, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.