Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC37A4 cdna clone

SLC37A4 cDNA Clone

Gene Names
SLC37A4; G6PT1; G6PT2; G6PT3; GSD1b; GSD1c; GSD1d; TRG19; TRG-19; PRO0685
Synonyms
SLC37A4; SLC37A4 cDNA Clone; SLC37A4 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagcccagggctatggctattatcgcactgtgatcttctcagccatgtttgggggctacagcctgtattacttcaatcgcaagaccttctcctttgtcatgccatcattggtggaagagatccctttggacaaggatgatttggggttcatcaccagcagccagtcggcagcttatgctatcagcaagtttgtcagtggggtgctgtctgaccagatgagtgctcgctggctcttctcttctgggctgctcctggttggcctggtcaacatattctttgcctggagctccacagtacctgtctttgctgccctctggttccttaatggcctggcccaggggctgggctggcccccatgtgggaaggtcctgcggaagtggtttgagccatctcagtttggcacttggtgggccatcctgtcaaccagcatgaacctggctggagggctgggccctatcctggcaaccatccttgcccagagctacagctggcgcagcacgctggccctatctggggcactgtgtgtggttgtctccttcctctgtctcctgctcatccacaatgaacctgctgatgttggactccgcaacctggaccccatgccctctgagggcaagaagggctccttgaaggaggagagcaccctgcaggagctgctgctgtccccttacctgtgggtgctctccactggttaccttgtggtgtttggagtaaagacctgctgtactgactggggccagttcttccttatccaggagaaaggacagtcagcccttgtaggtagctcctacatgagtgccctggaagttgggggccttgtaggcagcatcgcagctggctacctgtcagaccgggccatggcaaaggcgggactgtccaactacgggaaccctcgccatggcctgttgctgttcatgatggctggcatgacagtgtccatgtacctcttccgggtaacagtgaccagtgactcccccaagctctggatcctggtattgggagctgtatttggtttctcctcgtatggccccattgccctgtttggagtcatagccaacgagagtgcccctcccaacttgtgtggcacctcccacgccattgtgggactcatggccaatgtgggcggctttctggctgggctgcccttcagcaccattgccaagcactacagttggagcacagccttctgggtggctgaagtgatttgtgcggccagcacggctgccttcttcctcctacgaaacatccgcaccaagatgggccgagtgtccaagaaggctgagtga
Sequence Length
1290
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,840 Da
NCBI Official Full Name
Homo sapiens solute carrier family 37 (glucose-6-phosphate transporter), member 4, mRNA
NCBI Official Synonym Full Names
solute carrier family 37 member 4
NCBI Official Symbol
SLC37A4
NCBI Official Synonym Symbols
G6PT1; G6PT2; G6PT3; GSD1b; GSD1c; GSD1d; TRG19; TRG-19; PRO0685
NCBI Protein Information
glucose-6-phosphate exchanger SLC37A4
UniProt Protein Name
Glucose-6-phosphate exchanger SLC37A4
UniProt Gene Name
SLC37A4
UniProt Synonym Gene Names
TRG-19
UniProt Entry Name
G6PT1_HUMAN

NCBI Description

This gene regulates glucose-6-phosphate transport from the cytoplasm to the lumen of the endoplasmic reticulum, in order to maintain glucose homeostasis. It also plays a role in ATP-mediated calcium sequestration in the lumen of the endoplasmic reticulum. Mutations in this gene have been associated with various forms of glycogen storage disease. Alternative splicing in this gene results in multiple transcript variants.[provided by RefSeq, Aug 2009]

Uniprot Description

SLC37A4: Transports glucose-6-phosphate from the cytoplasm to the lumen of the endoplasmic reticulum. Forms with glucose-6- phosphatase the complex responsible for glucose production through glycogenolysis and gluconeogenesis. Hence, it plays a central role in homeostatic regulation of blood glucose levels. Defects in SLC37A4 are the cause of glycogen storage disease type 1B (GSD1B). GSD1B is a metabolic disorder characterized by impairment of terminal steps of glycogenolysis and gluconeogenesis. GSD1 patients manifest a wide range of clinical symptoms and biochemical abnormalities, including hypoglycemia, severe hepatomegaly due to excessive accumulation of glycogen, kidney enlargement, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. GSD1B patients also present a tendency towards infections associated with neutropenia, relapsing aphthous gingivostomatitis, and inflammatory bowel disease. Defects in SLC37A4 are the cause of glycogen storage disease type 1C (GSD1C). Defects in SLC37A4 are the cause of glycogen storage disease type 1D (GSD1D). Belongs to the major facilitator superfamily. Organophosphate:Pi antiporter (OPA) (TC 2.A.1.4) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Transporter; Transporter, SLC family

Chromosomal Location of Human Ortholog: 11q23.3

Cellular Component: endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane; membrane

Molecular Function: glucose-6-phosphate transmembrane transporter activity

Biological Process: glucose transport; glucose-6-phosphate transport; positive regulation of defense response to virus by host

Disease: Glycogen Storage Disease Ib; Glycogen Storage Disease Ic

Research Articles on SLC37A4

Similar Products

Product Notes

The SLC37A4 slc37a4 (Catalog #AAA1266308) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagccc agggctatgg ctattatcgc actgtgatct tctcagccat gtttgggggc tacagcctgt attacttcaa tcgcaagacc ttctcctttg tcatgccatc attggtggaa gagatccctt tggacaagga tgatttgggg ttcatcacca gcagccagtc ggcagcttat gctatcagca agtttgtcag tggggtgctg tctgaccaga tgagtgctcg ctggctcttc tcttctgggc tgctcctggt tggcctggtc aacatattct ttgcctggag ctccacagta cctgtctttg ctgccctctg gttccttaat ggcctggccc aggggctggg ctggccccca tgtgggaagg tcctgcggaa gtggtttgag ccatctcagt ttggcacttg gtgggccatc ctgtcaacca gcatgaacct ggctggaggg ctgggcccta tcctggcaac catccttgcc cagagctaca gctggcgcag cacgctggcc ctatctgggg cactgtgtgt ggttgtctcc ttcctctgtc tcctgctcat ccacaatgaa cctgctgatg ttggactccg caacctggac cccatgccct ctgagggcaa gaagggctcc ttgaaggagg agagcaccct gcaggagctg ctgctgtccc cttacctgtg ggtgctctcc actggttacc ttgtggtgtt tggagtaaag acctgctgta ctgactgggg ccagttcttc cttatccagg agaaaggaca gtcagccctt gtaggtagct cctacatgag tgccctggaa gttgggggcc ttgtaggcag catcgcagct ggctacctgt cagaccgggc catggcaaag gcgggactgt ccaactacgg gaaccctcgc catggcctgt tgctgttcat gatggctggc atgacagtgt ccatgtacct cttccgggta acagtgacca gtgactcccc caagctctgg atcctggtat tgggagctgt atttggtttc tcctcgtatg gccccattgc cctgtttgga gtcatagcca acgagagtgc ccctcccaac ttgtgtggca cctcccacgc cattgtggga ctcatggcca atgtgggcgg ctttctggct gggctgccct tcagcaccat tgccaagcac tacagttgga gcacagcctt ctgggtggct gaagtgattt gtgcggccag cacggctgcc ttcttcctcc tacgaaacat ccgcaccaag atgggccgag tgtccaagaa ggctgagtga. It is sometimes possible for the material contained within the vial of "SLC37A4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.