Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF3 cdna clone

ZNF3 cDNA Clone

Gene Names
ZNF3; A8-51; HF.12; KOX25; PP838; Zfp113
Synonyms
ZNF3; ZNF3 cDNA Clone; ZNF3 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaactcaggctgatctcgtatctcaggaacctcaggccctgcttgacagtgctcttccttcaaaagttcctgccttttccgacaaggacagcctgggggatgagatgttggcggctgcgctcctaaaggccaagtcccaggagctggtaacctttgaggatgtagctgtgtacttcatccggaaggagtggaagcgtttggaacctgctcagagggacctctatagagatgtgatgctggagaattacgggaatgtgttctcactggatcgtgagaccaggactgaaaatgatcaagaaatttctgaagacacaagatcacatggggtcctactgggaagatttcaaaaggatatttctcagggtctcaagtttaaagaagcctatgaacgagaagtcagtctgaaaaggccgctggggaactcccctggagaaagactgaacaggaaaatgccagattttggtcaagtgacagttgaggagaagctaacccccaggggagagagaagcgagaaatataatgattttgggaacagcttcactgtgaattccaaccttatctcacatcagagactccccgtgggagacagaccccataagtgtgatgaatgtagcaagagctttaatcgaacttcagaccttattcaacatcagagaatccacactggggaaaagccctatgaatgtaatgagtgtgggaaggccttcagccagagctcacaccttattcagcatcagagaatccacactggggaaaaaccttatgaatgtagtgattgtgggaaaaccttcagctgtagctctgccctcattctgcatcggaggatccacacgggggagaaaccctatgaatgtaatgagtgtgggaagaccttcagctggagctccaccctcacccaccatcagagaatccacactggtgagaaaccctacgcctgcaatgaatgtgggaaggccttcagcaggagctcaacccttattcaccatcagagaatccacactggagaaaaaccctatgaatgtaatgaatgtgggaaagccttcagccagagctcacacctctatcagcaccagagaatccacactggagagaagccctacgaatgtatggaatgtggaggaaagtttacctacagttcaggccttattcagcatcaaagaatccacaccggggagaacccctatgaatgtagtgagtgtgggaaagccttcaggtacagctcggctcttgttcgccatcagagaattcacactggagagaagcctttgaatgggatcggcatgagcaaaagctccctcagagttacgaccgagttaaatatcagagagtccacgtga
Sequence Length
1341
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,627 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 3, mRNA
NCBI Official Synonym Full Names
zinc finger protein 3
NCBI Official Symbol
ZNF3
NCBI Official Synonym Symbols
A8-51; HF.12; KOX25; PP838; Zfp113
NCBI Protein Information
zinc finger protein 3
UniProt Protein Name
Zinc finger protein 3
UniProt Gene Name
ZNF3
UniProt Synonym Gene Names
KOX25
UniProt Entry Name
ZNF3_HUMAN

Uniprot Description

ZNF38: Involved in cell differentiation and/or proliferation. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; DNA-binding; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 7q22.1

Cellular Component: nucleus

Molecular Function: identical protein binding; protein binding; transcription factor activity

Biological Process: regulation of transcription, DNA-dependent

Research Articles on ZNF3

Similar Products

Product Notes

The ZNF3 znf3 (Catalog #AAA1266298) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaactc aggctgatct cgtatctcag gaacctcagg ccctgcttga cagtgctctt ccttcaaaag ttcctgcctt ttccgacaag gacagcctgg gggatgagat gttggcggct gcgctcctaa aggccaagtc ccaggagctg gtaacctttg aggatgtagc tgtgtacttc atccggaagg agtggaagcg tttggaacct gctcagaggg acctctatag agatgtgatg ctggagaatt acgggaatgt gttctcactg gatcgtgaga ccaggactga aaatgatcaa gaaatttctg aagacacaag atcacatggg gtcctactgg gaagatttca aaaggatatt tctcagggtc tcaagtttaa agaagcctat gaacgagaag tcagtctgaa aaggccgctg gggaactccc ctggagaaag actgaacagg aaaatgccag attttggtca agtgacagtt gaggagaagc taacccccag gggagagaga agcgagaaat ataatgattt tgggaacagc ttcactgtga attccaacct tatctcacat cagagactcc ccgtgggaga cagaccccat aagtgtgatg aatgtagcaa gagctttaat cgaacttcag accttattca acatcagaga atccacactg gggaaaagcc ctatgaatgt aatgagtgtg ggaaggcctt cagccagagc tcacacctta ttcagcatca gagaatccac actggggaaa aaccttatga atgtagtgat tgtgggaaaa ccttcagctg tagctctgcc ctcattctgc atcggaggat ccacacgggg gagaaaccct atgaatgtaa tgagtgtggg aagaccttca gctggagctc caccctcacc caccatcaga gaatccacac tggtgagaaa ccctacgcct gcaatgaatg tgggaaggcc ttcagcagga gctcaaccct tattcaccat cagagaatcc acactggaga aaaaccctat gaatgtaatg aatgtgggaa agccttcagc cagagctcac acctctatca gcaccagaga atccacactg gagagaagcc ctacgaatgt atggaatgtg gaggaaagtt tacctacagt tcaggcctta ttcagcatca aagaatccac accggggaga acccctatga atgtagtgag tgtgggaaag ccttcaggta cagctcggct cttgttcgcc atcagagaat tcacactgga gagaagcctt tgaatgggat cggcatgagc aaaagctccc tcagagttac gaccgagtta aatatcagag agtccacgtg a. It is sometimes possible for the material contained within the vial of "ZNF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.