TMEM30A cdna clone
TMEM30A cDNA Clone
Gene Names
TMEM30A; CDC50A; C6orf67
Synonyms
TMEM30A; TMEM30A cDNA Clone; TMEM30A cdna clone
Sequence
atggcgatgaactataacgcgaaggatgaagtggacggtgggcccccgtgtgctccggggggcaccgcgaagactcggagaccggataacacggccttcaaacagcaacggctgccagcttggcagcccatccttacggctggcacggtgctacctattttcttcatcatcggtctcatcttcattcccatcggcattggcatttttgtcacctccaacaacatccgcgagatcgagggcaacgtgtttatgtattatggactgtctaatttctatcaaaaccatcgtcgttacgtgaaatctcgagatgatagtcaactaaatggagattctagtgctttgcttaatcccagtaaggaatgtgaaccttatcgaagaaatgaagacaaaccaattgctccttgtggagctattgccaacagcatgtttaatgatacattagaattgtttctcattggcaatgattcttatcctatacctatcgctttgaaaaagaaaggtattgcttggtggacagataaaaatgtgaaattcagaaatccccctggaggagacaacctggaagaacgatttaaaggtacaacaaagcctgtgaactggcttaaaccagtttacatgctggattctgacccagataataatggattcataaatgaggattttattgtttggatgcgtactgcagcattacctacttttcgcaagttgtatcgtcttatagaaaggaaaagtgatttacatccaacattaccagctggccgatactctttgaatgtcacatacaattaccctgtacattattttgatggacgaaaacggatgatcttgagcactatttcatggatgggaggaaaaaatccatttttggggattgcttacatcgctgttggatccatctccttccttctgggagttgtactgctagtaattaatcataaatatagaaacagtagtaatacagctgacattaccatttaa
Sequence Length
978
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,729 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 30A, mRNA
NCBI Official Synonym Full Names
transmembrane protein 30A
NCBI Official Symbol
TMEM30A
NCBI Official Synonym Symbols
CDC50A; C6orf67
NCBI Protein Information
cell cycle control protein 50A
UniProt Protein Name
Cell cycle control protein 50A
Protein Family
UniProt Gene Name
TMEM30A
UniProt Synonym Gene Names
C6orf67; CDC50A
UniProt Entry Name
CC50A_HUMAN
Uniprot Description
TMEM30A: Belongs to the CDC50/LEM3 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 6q14.1
Cellular Component: endoplasmic reticulum; membrane
Molecular Function: protein binding
Biological Process: multidrug transport; phospholipid translocation
Research Articles on TMEM30A
Similar Products
Product Notes
The TMEM30A tmem30a (Catalog #AAA1266274) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgatga actataacgc gaaggatgaa gtggacggtg ggcccccgtg tgctccgggg ggcaccgcga agactcggag accggataac acggccttca aacagcaacg gctgccagct tggcagccca tccttacggc tggcacggtg ctacctattt tcttcatcat cggtctcatc ttcattccca tcggcattgg catttttgtc acctccaaca acatccgcga gatcgagggc aacgtgttta tgtattatgg actgtctaat ttctatcaaa accatcgtcg ttacgtgaaa tctcgagatg atagtcaact aaatggagat tctagtgctt tgcttaatcc cagtaaggaa tgtgaacctt atcgaagaaa tgaagacaaa ccaattgctc cttgtggagc tattgccaac agcatgttta atgatacatt agaattgttt ctcattggca atgattctta tcctatacct atcgctttga aaaagaaagg tattgcttgg tggacagata aaaatgtgaa attcagaaat ccccctggag gagacaacct ggaagaacga tttaaaggta caacaaagcc tgtgaactgg cttaaaccag tttacatgct ggattctgac ccagataata atggattcat aaatgaggat tttattgttt ggatgcgtac tgcagcatta cctacttttc gcaagttgta tcgtcttata gaaaggaaaa gtgatttaca tccaacatta ccagctggcc gatactcttt gaatgtcaca tacaattacc ctgtacatta ttttgatgga cgaaaacgga tgatcttgag cactatttca tggatgggag gaaaaaatcc atttttgggg attgcttaca tcgctgttgg atccatctcc ttccttctgg gagttgtact gctagtaatt aatcataaat atagaaacag tagtaataca gctgacatta ccatttaa. It is sometimes possible for the material contained within the vial of "TMEM30A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
