Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

Figure 1

INF2 cdna clone

INF2 cDNA Clone

Gene Names
INF2; FSGS5; CMTDIE; pp9484; C14orf151; C14orf173
Synonyms
INF2; INF2 cDNA Clone; INF2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggtgaaggagggcgcacagcgcaagtgggcagcgctgaaggagaagctggggccacaggattcggaccccacggaggccaacctggagagcgcggaccctgagctgtgcatccggctgctccagatgccctctgtggtcaactactccggcctgcgcaagcgcctggagggcagcgacggcggctggatggtgcagttcctggagcagagcggcctggacctgctgctggaggcgctggcgcggctgtcgggccgcggcgttgcacgtatctccgacgccctgctgcagctcacctgcgtcagctgcgtgcgcgccgtcatgaactcgcggcagggcatcgagtacatcctcagcaaccagggctacgtgcgccagctctcccaggccctggacacatccaacgtgatggtgaagaagcaggtgtttgagctactggctgccctgtgcatctactctcccgagggccacgtgctgaccctggacgccctggaccactacaagacggtgtgcagccagcagtaccgcttcagcattgtcatgaacgagctctccggcagcgacaacgtgccctacgtggtcaccctgcttagcgtgatcaacgccgtcatcttgggccccgaggacctgcgcgcgcgcacccagctgcggaacgagtttatcgggctgcagctgctggacgtcctggctcgcctgcggtga
Sequence Length
705
Vector
Please Inquire

Figure 1

Figure 1

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,954 Da
NCBI Official Full Name
Homo sapiens inverted formin, FH2 and WH2 domain containing, mRNA
NCBI Official Synonym Full Names
inverted formin, FH2 and WH2 domain containing
NCBI Official Symbol
INF2
NCBI Official Synonym Symbols
FSGS5; CMTDIE; pp9484; C14orf151; C14orf173
NCBI Protein Information
inverted formin-2
UniProt Protein Name
Inverted formin-2
Protein Family
UniProt Gene Name
INF2
UniProt Synonym Gene Names
C14orf151; C14orf173
UniProt Entry Name
INF2_HUMAN

NCBI Description

This gene represents a member of the formin family of proteins. It is considered a diaphanous formin due to the presence of a diaphanous inhibitory domain located at the N-terminus of the encoded protein. Studies of a similar mouse protein indicate that the protein encoded by this locus may function in polymerization and depolymerization of actin filaments. Mutations at this locus have been associated with focal segmental glomerulosclerosis 5.[provided by RefSeq, Aug 2010]

Uniprot Description

INF2: Severs actin filaments and accelerates their polymerization and depolymerization. Defects in INF2 are the cause of focal segmental glomerulosclerosis type 5 (FSGS5). A renal pathology defined by the presence of segmental sclerosis in glomeruli and resulting in proteinuria, reduced glomerular filtration rate and edema. Renal insufficiency often progresses to end-stage renal disease, a highly morbid state requiring either dialysis therapy or kidney transplantation. Defects in INF2 are the cause of Charcot-Marie-Tooth disease, dominant intermediate type E (CMTDIE). A form of Charcot-Marie-Tooth disease, a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. The dominant intermediate type E is characterized by clinical and pathologic features intermediate between demyelinating and axonal peripheral neuropathies, and motor median nerve conduction velocities ranging from 25 to 45 m/sec. Patients additionally manifest focal segmental glomerulonephritis, proteinuria, progression to end- stage renal disease, and a characteristic histologic pattern on renal biopsy. Belongs to the formin homology family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 14q32.33

Cellular Component: perinuclear region of cytoplasm

Disease: Charcot-marie-tooth Disease, Dominant Intermediate E; Focal Segmental Glomerulosclerosis 5

Research Articles on INF2

Similar Products

Product Notes

The INF2 inf2 (Catalog #AAA1266219) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggtga aggagggcgc acagcgcaag tgggcagcgc tgaaggagaa gctggggcca caggattcgg accccacgga ggccaacctg gagagcgcgg accctgagct gtgcatccgg ctgctccaga tgccctctgt ggtcaactac tccggcctgc gcaagcgcct ggagggcagc gacggcggct ggatggtgca gttcctggag cagagcggcc tggacctgct gctggaggcg ctggcgcggc tgtcgggccg cggcgttgca cgtatctccg acgccctgct gcagctcacc tgcgtcagct gcgtgcgcgc cgtcatgaac tcgcggcagg gcatcgagta catcctcagc aaccagggct acgtgcgcca gctctcccag gccctggaca catccaacgt gatggtgaag aagcaggtgt ttgagctact ggctgccctg tgcatctact ctcccgaggg ccacgtgctg accctggacg ccctggacca ctacaagacg gtgtgcagcc agcagtaccg cttcagcatt gtcatgaacg agctctccgg cagcgacaac gtgccctacg tggtcaccct gcttagcgtg atcaacgccg tcatcttggg ccccgaggac ctgcgcgcgc gcacccagct gcggaacgag tttatcgggc tgcagctgct ggacgtcctg gctcgcctgc ggtga. It is sometimes possible for the material contained within the vial of "INF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.