C8orf22 cdna clone
C8orf22 cDNA Clone
Synonyms
C8orf22; C8orf22 cDNA Clone; C8orf22 cdna clone
Sequence
atggcatccgtaccttccattggttgccttctagccagaaatcagtattatcgaaagtccagtgtttcttcagttagttctttaactagctctgattctgttaacttcatagatgacgacaaaccacagcaagggttgcctgaagtggcagaatccacctggtggtttaaatcgtttttccattctgaacctgtgctttcaaatgtgagaataaaagatctgtctgctactggcatgaacagttga
Sequence Length
246
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
9,274 Da
NCBI Official Full Name
Homo sapiens chromosome 8 open reading frame 22, mRNA
NCBI Official Synonym Full Names
chromosome 8 open reading frame 22
NCBI Official Symbol
C8orf22
NCBI Protein Information
pancreatic progenitor cell differentiation and proliferation factor-like protein
UniProt Protein Name
Pancreatic progenitor cell differentiation and proliferation factor-like protein
UniProt Gene Name
C8orf22
UniProt Entry Name
PDPFL_HUMAN
Uniprot Description
C8orf22: Belongs to the PPDPF family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 8q11
Biological Process: cell fate specification; exocrine pancreas development
Similar Products
Product Notes
The C8orf22 c8orf22 (Catalog #AAA1266218) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatccg taccttccat tggttgcctt ctagccagaa atcagtatta tcgaaagtcc agtgtttctt cagttagttc tttaactagc tctgattctg ttaacttcat agatgacgac aaaccacagc aagggttgcc tgaagtggca gaatccacct ggtggtttaa atcgtttttc cattctgaac ctgtgctttc aaatgtgaga ataaaagatc tgtctgctac tggcatgaac agttga. It is sometimes possible for the material contained within the vial of "C8orf22, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
