Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDO1 cdna clone

CDO1 cDNA Clone

Gene Names
CDO1; CDO-I
Synonyms
CDO1; CDO1 cDNA Clone; CDO1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaacagaccgaagtgctgaagccacggaccctggctgatctgatccgcatcctgcaccagctctttgccggcgatgaggtcaatgtagaggaggtgcaggccatcatggaagcctacgagagcgaccccaccgagtgggcaatgtacgccaagttcgaccagtacaggtatacccgaaatcttgtggatcaaggaaatggaaaatttaatctgatgattctctgttggggtgaaggacatggcagcagtattcatgatcataccaactcccactgctttctgaagatgctacagggaaatctaaaggagacattatttgcctggcctgacaaaaaatccaatgagatggtcaagaagtctgaaagagtcttgagggaaaaccagtgtgcctacatcaatgattccgttggcttacatcgagtagagaacatcagccatacggaacctgctgtgagccttcacttgtacagtccaccttttgatacatgccatgcctttgatcaaagaacaggacataaaaacaaagtcacaatgacattccatagtaaatttggaatcagaactccaaatgcaacttcgggctcgctggagaacaactaa
Sequence Length
603
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,972 Da
NCBI Official Full Name
Homo sapiens cysteine dioxygenase, type I, mRNA
NCBI Official Synonym Full Names
cysteine dioxygenase type 1
NCBI Official Symbol
CDO1
NCBI Official Synonym Symbols
CDO-I
NCBI Protein Information
cysteine dioxygenase type 1
UniProt Protein Name
Cysteine dioxygenase type 1
Protein Family
UniProt Gene Name
CDO1
UniProt Synonym Gene Names
CDO; CDO-I
UniProt Entry Name
CDO1_HUMAN

Uniprot Description

CDO1: Initiates several important metabolic pathways related to pyruvate and several sulfurate compounds including sulfate, hypotaurine and taurine. Critical regulator of cellular cysteine concentrations. Has an important role in maintaining the hepatic concentation of intracellular free cysteine within a proper narrow range. Belongs to the cysteine dioxygenase family.

Protein type: Amino Acid Metabolism - cysteine and methionine; Other Amino Acids Metabolism - taurine and hypotaurine; Oxidoreductase; EC 1.13.11.20

Chromosomal Location of Human Ortholog: 5q23.2

Cellular Component: cytosol

Molecular Function: cysteine dioxygenase activity

Biological Process: cysteine metabolic process; inflammatory response; L-cysteine catabolic process; L-cysteine catabolic process to pyruvate, using cysteine dioxygenase; sulfur amino acid biosynthetic process; taurine biosynthetic process

Research Articles on CDO1

Similar Products

Product Notes

The CDO1 cdo1 (Catalog #AAA1266190) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaacaga ccgaagtgct gaagccacgg accctggctg atctgatccg catcctgcac cagctctttg ccggcgatga ggtcaatgta gaggaggtgc aggccatcat ggaagcctac gagagcgacc ccaccgagtg ggcaatgtac gccaagttcg accagtacag gtatacccga aatcttgtgg atcaaggaaa tggaaaattt aatctgatga ttctctgttg gggtgaagga catggcagca gtattcatga tcataccaac tcccactgct ttctgaagat gctacaggga aatctaaagg agacattatt tgcctggcct gacaaaaaat ccaatgagat ggtcaagaag tctgaaagag tcttgaggga aaaccagtgt gcctacatca atgattccgt tggcttacat cgagtagaga acatcagcca tacggaacct gctgtgagcc ttcacttgta cagtccacct tttgatacat gccatgcctt tgatcaaaga acaggacata aaaacaaagt cacaatgaca ttccatagta aatttggaat cagaactcca aatgcaactt cgggctcgct ggagaacaac taa. It is sometimes possible for the material contained within the vial of "CDO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.