Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDIA3 cdna clone

PDIA3 cDNA Clone

Gene Names
PDIA3; P58; ER60; ERp57; ERp60; ERp61; GRP57; GRP58; PI-PLC; HsT17083; HEL-S-269; HEL-S-93n
Synonyms
PDIA3; PDIA3 cDNA Clone; PDIA3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgcctccgccgcctagcgctgttcccgggtgtggcgctgcttcttgccgcggcccgcctcgccgctgcctccgacgtgctagaactcacggacgacaacttcgagagtcgcatctccgacacgggctctgcgggcctcatgctcgtcgagttcttcgccccctggtgtggacactgcaagagacttgcacctgagtatgaagctgcagctaccagattaaaaggaatagtcccattagcaaaggttgattgcactgccaacactaacacctgtaataaatatggagtcagtggatatccaaccctgaagatatttagagatggtgaagaagcaggtgcttatgatggacctaggactgctgatggaattgtcagccacttgaagaagcaggcaggaccagcttcagtgcctctcaggactgaggaagaatttaagaaattcattagtgataaagatgcctctatagtaggttttttcgatgattcattcagtgaggctcactccgagttcctaaaagcagccagcaacttgagggataactaccgatttgcacatacgaatgttgagtctctggtgaacgagtatgatgataatggagagggtatcatcttatttcgtccttcacatctcactaacaagtttgaggacaagactgtggcatatacagagcaaaaaatgaccagtggcaaaattaaaaagtttatccaggaaaacatttttggtatctgccctcacatgacagaagacaataaagatttgatacagggcaaggacttacttattgcttactatgatgtggactatgaaaagaacgctaaaggttccaactactggagaaacagggtaatgatggtggcaaagaaattcctggatgctgggcacaaactcaactttgctgtagctagccgcaaaacctttagccatgaactttctgattttggcttggagagcactgctggagagattcctgttgttgctatcagaactgctaaaggagagaagtttgtcatgcaggaggagttctcgcgtgatgggaaggctctggagaggttcctgcaggattactttgatggcaatctgaagagatacctgaagtctgaacctatcccagagagcaatgatgggcctgtgaaggtagtggtagcagagaattttgatgaaatagtgaataatgaaaataaagatgtgctgattgaattttatgccccttggtgtggtcactgtaagaacctggagcccaagtataaagaacttggcgagaagctcagcaaagacccaaatatcgtcatagccaagatggatgccacagccaatgatgtgccttctccatatgaagtcagaggttttcctaccatatacttctctccagccaacaagaagctaaatccaaagaaatatgaaggtggccgtgaattaagtgattttattagctatctacaaagagaagctacaaacccccctgtaattcaagaagaaaaacccaagaagaagaagaaggcacaggaggatctctaa
Sequence Length
1518
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,782 Da
NCBI Official Full Name
Homo sapiens protein disulfide isomerase family A, member 3, mRNA
NCBI Official Synonym Full Names
protein disulfide isomerase family A member 3
NCBI Official Symbol
PDIA3
NCBI Official Synonym Symbols
P58; ER60; ERp57; ERp60; ERp61; GRP57; GRP58; PI-PLC; HsT17083; HEL-S-269; HEL-S-93n
NCBI Protein Information
protein disulfide-isomerase A3
UniProt Protein Name
Protein disulfide-isomerase A3
UniProt Gene Name
PDIA3
UniProt Synonym Gene Names
ERP57; ERP60; GRP58; p58; ER protein 57; ERp57; ER protein 60; ERp60
UniProt Entry Name
PDIA3_HUMAN

NCBI Description

This gene encodes a protein of the endoplasmic reticulum that interacts with lectin chaperones calreticulin and calnexin to modulate folding of newly synthesized glycoproteins. The protein was once thought to be a phospholipase; however, it has been demonstrated that the protein actually has protein disulfide isomerase activity. It is thought that complexes of lectins and this protein mediate protein folding by promoting formation of disulfide bonds in their glycoprotein substrates. [provided by RefSeq, Jul 2008]

Uniprot Description

GRP58: a protein disulfide isomerase found in the endoplasmic reticulum lumen. Catalyzes the rearrangement of both intrachain and interchain disulfide bonds in proteins to form the native structures. An essential component of the peptide-loading complex of the major histocompatibility complex class I pathway.

Protein type: Chaperone; Isomerase; EC 5.3.4.1; Endoplasmic reticulum; Phospholipase; Apoptosis; Protease

Chromosomal Location of Human Ortholog: 15q15

Cellular Component: cell surface; endoplasmic reticulum; endoplasmic reticulum lumen; focal adhesion; nucleus

Molecular Function: cysteine-type endopeptidase activity; disulfide oxidoreductase activity; phospholipase C activity; protein binding

Biological Process: antigen processing and presentation of peptide antigen via MHC class I; protein folding; protein import into nucleus; protein retention in ER; signal transduction

Research Articles on PDIA3

Similar Products

Product Notes

The PDIA3 pdia3 (Catalog #AAA1266189) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgcctcc gccgcctagc gctgttcccg ggtgtggcgc tgcttcttgc cgcggcccgc ctcgccgctg cctccgacgt gctagaactc acggacgaca acttcgagag tcgcatctcc gacacgggct ctgcgggcct catgctcgtc gagttcttcg ccccctggtg tggacactgc aagagacttg cacctgagta tgaagctgca gctaccagat taaaaggaat agtcccatta gcaaaggttg attgcactgc caacactaac acctgtaata aatatggagt cagtggatat ccaaccctga agatatttag agatggtgaa gaagcaggtg cttatgatgg acctaggact gctgatggaa ttgtcagcca cttgaagaag caggcaggac cagcttcagt gcctctcagg actgaggaag aatttaagaa attcattagt gataaagatg cctctatagt aggttttttc gatgattcat tcagtgaggc tcactccgag ttcctaaaag cagccagcaa cttgagggat aactaccgat ttgcacatac gaatgttgag tctctggtga acgagtatga tgataatgga gagggtatca tcttatttcg tccttcacat ctcactaaca agtttgagga caagactgtg gcatatacag agcaaaaaat gaccagtggc aaaattaaaa agtttatcca ggaaaacatt tttggtatct gccctcacat gacagaagac aataaagatt tgatacaggg caaggactta cttattgctt actatgatgt ggactatgaa aagaacgcta aaggttccaa ctactggaga aacagggtaa tgatggtggc aaagaaattc ctggatgctg ggcacaaact caactttgct gtagctagcc gcaaaacctt tagccatgaa ctttctgatt ttggcttgga gagcactgct ggagagattc ctgttgttgc tatcagaact gctaaaggag agaagtttgt catgcaggag gagttctcgc gtgatgggaa ggctctggag aggttcctgc aggattactt tgatggcaat ctgaagagat acctgaagtc tgaacctatc ccagagagca atgatgggcc tgtgaaggta gtggtagcag agaattttga tgaaatagtg aataatgaaa ataaagatgt gctgattgaa ttttatgccc cttggtgtgg tcactgtaag aacctggagc ccaagtataa agaacttggc gagaagctca gcaaagaccc aaatatcgtc atagccaaga tggatgccac agccaatgat gtgccttctc catatgaagt cagaggtttt cctaccatat acttctctcc agccaacaag aagctaaatc caaagaaata tgaaggtggc cgtgaattaa gtgattttat tagctatcta caaagagaag ctacaaaccc ccctgtaatt caagaagaaa aacccaagaa gaagaagaag gcacaggagg atctctaa. It is sometimes possible for the material contained within the vial of "PDIA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.