Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

POLE3 cdna clone

POLE3 cDNA Clone

Gene Names
POLE3; p17; YBL1; CHRAC17; CHARAC17
Synonyms
POLE3; POLE3 cDNA Clone; POLE3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggagaggcccgaggacctaaacctgcccaatgccgtgatcaccaggatcatcaaggaggcgctcccggacggtgtcaacatctccaaggaggcccggagcgccatctcccgcgccgccagcgtcttcgtgctgtacgccacatcctgtgctaacaactttgcaatgaaaggaaagcggaagacgctgaatgccagtgatgtgctctcagccatggaagagatggagttccagcggttcgttaccccattgaaagaagctctggaagcatataggcgggagcagaaaggcaagaaggaggcctcagagcaaaagaagaaggacaaagacaaaaaaacagactcggaagagcaagacaagagcagggatgaggacaatgatgaagacgaagaaaggctggaagaagaagaacagaatgaagaggaagaagtagacaactga
Sequence Length
444
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,860 Da
NCBI Official Full Name
Homo sapiens polymerase (DNA directed), epsilon 3 (p17 subunit), mRNA
NCBI Official Synonym Full Names
DNA polymerase epsilon 3, accessory subunit
NCBI Official Symbol
POLE3
NCBI Official Synonym Symbols
p17; YBL1; CHRAC17; CHARAC17
NCBI Protein Information
DNA polymerase epsilon subunit 3
UniProt Protein Name
DNA polymerase epsilon subunit 3
Protein Family
UniProt Gene Name
POLE3
UniProt Synonym Gene Names
CHRAC17; AsTP; CHRAC-17; HuCHRAC17
UniProt Entry Name
DPOE3_HUMAN

NCBI Description

POLE3 is a histone-fold protein that interacts with other histone-fold proteins to bind DNA in a sequence-independent manner. These histone-fold protein dimers combine within larger enzymatic complexes for DNA transcription, replication, and packaging.[supplied by OMIM, Apr 2004]

Uniprot Description

POLE3: Forms a complex with DNA polymerase epsilon subunit CHRAC1 and binds naked DNA, which is then incorporated into chromatin, aided by the nucleosome-remodeling activity of ISWI/SNF2H and ACF1.

Protein type: Nucleotide Metabolism - purine; DNA replication; Transferase; EC 2.7.7.7; Nucleotide Metabolism - pyrimidine

Chromosomal Location of Human Ortholog: 9q33

Cellular Component: epsilon DNA polymerase complex; nucleus

Molecular Function: protein binding

Biological Process: DNA replication

Similar Products

Product Notes

The POLE3 pole3 (Catalog #AAA1266074) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggaga ggcccgagga cctaaacctg cccaatgccg tgatcaccag gatcatcaag gaggcgctcc cggacggtgt caacatctcc aaggaggccc ggagcgccat ctcccgcgcc gccagcgtct tcgtgctgta cgccacatcc tgtgctaaca actttgcaat gaaaggaaag cggaagacgc tgaatgccag tgatgtgctc tcagccatgg aagagatgga gttccagcgg ttcgttaccc cattgaaaga agctctggaa gcatataggc gggagcagaa aggcaagaag gaggcctcag agcaaaagaa gaaggacaaa gacaaaaaaa cagactcgga agagcaagac aagagcaggg atgaggacaa tgatgaagac gaagaaaggc tggaagaaga agaacagaat gaagaggaag aagtagacaa ctga. It is sometimes possible for the material contained within the vial of "POLE3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.