Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALDH4A1 cdna clone

ALDH4A1 cDNA Clone

Gene Names
ALDH4A1; P5CD; ALDH4; P5CDh
Synonyms
ALDH4A1; ALDH4A1 cDNA Clone; ALDH4A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgctgccggcgcccgcgctccgccgcgccctgctgtcccgcccctggaccggggccggcctgcggtggaagcacacctcctccctgaaggtggccaacgagcccgtcttagccttcacgcagggcagccctgagcgagatgccctgcaaaaggccttgaaggacctgaagggccggatggaagccatcccatgcgtggtgggggatgaggaggtgtggacgtcggacgtgcagtaccaagtgtcgccttttaaccatggacataaggtggccaagttctgttatgcagacaagagcctgctcaacaaagccattgaggctgccctggctgcccggaaagagtgggacctgaagcctattgcagaccgggcccagatcttcctgaaggcggcagacatgctgagtgggccgcgcagggctgagatcctcgccaagaccatggtgggacagggtaagaccgtgatccaagcggagattgacgctgcagcggaactcatcgacttcttccggttcaatgccaagtatgcggtggagctggaggggcagcagcccatcagcgtgcccccgagcaccaacagcacggtgtaccggggtctggagggcttcgtggcggccatctcgccctttaacttcactgcaatcggcggcaacctggcgggggcaccggccctgatgggcaacgtggtcctatggaagcccagtgacactgccatgctggccagctatgctgtctaccgcatccttcgggaggctggcctgccccccaacatcatccagtttgtgccagctgatgggcccctatttggggacactgtcaccagctcagagcacctctgtggcatcaacttcacaggcagtgtgcccaccttcaaacacctgtggaagcaggtggcccagaacctggaccggttccacaccttcccacgcctggctggagagtgcggcggaaagaacttccacttcgtgcaccgctcggccgacgtggagagcgtggtgagcgggaccctccgctcagccttcgagtacggtggccagaagtgttccgcctgctcgcgtctctacgtgccgcactcgctgtggccgcagatcaaagggcggctgctggaggagcacagtcggatcaaagtgggcgaccctgcagaggattttgggaccttcttctctgcagtgattgatgccaagtcctttgcccgtatcaagaagtggctggagcacgcacgctcctcacccagcctcaccatcctggccgggggcaagtgtgatgactccgtgggctactttgtggagccctgcatcgtggagagcaaggaccctcaggagcccatcatgaaggaggagatcttcgggcctgtactgtctgtgtacgtctacccggatgacaagtacaaggagacgctgcagctgattgacagcaccaccagctatggcctcacgggggcagtgttctcccaggataaggacgtcgtgcaggaggccacaaaggtgctgaggaatgctgccggcaacttctacatcaacgacaagtccactggctcgatagtgggccagcagccctttgggggggcccgagcctctggaaccaatgacaagccagggggcccacactacatcctgcgctggacgtcgccgcaggtcatcaaggagacacataagcccctgggggactggagctacgcgtacatgcagtga
Sequence Length
1692
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,043 Da
NCBI Official Full Name
Homo sapiens aldehyde dehydrogenase 4 family, member A1, mRNA
NCBI Official Synonym Full Names
aldehyde dehydrogenase 4 family member A1
NCBI Official Symbol
ALDH4A1
NCBI Official Synonym Symbols
P5CD; ALDH4; P5CDh
NCBI Protein Information
delta-1-pyrroline-5-carboxylate dehydrogenase, mitochondrial
UniProt Protein Name
Delta-1-pyrroline-5-carboxylate dehydrogenase, mitochondrial
UniProt Gene Name
ALDH4A1
UniProt Synonym Gene Names
ALDH4; P5CDH; P5C dehydrogenase
UniProt Entry Name
AL4A1_HUMAN

NCBI Description

This protein belongs to the aldehyde dehydrogenase family of proteins. This enzyme is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Deficiency of this enzyme is associated with type II hyperprolinemia, an autosomal recessive disorder characterized by accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2009]

Uniprot Description

ALDH4A1: Irreversible conversion of delta-1-pyrroline-5- carboxylate (P5C), derived either from proline or ornithine, to glutamate. This is a necessary step in the pathway interconnecting the urea and tricarboxylic acid cycles. The preferred substrate is glutamic gamma-semialdehyde, other substrates include succinic, glutaric and adipic semialdehydes. Defects in ALDH4A1 are the cause of hyperprolinemia type 2 (HP-2). HP-2 is characterized by the accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. The disorder may be causally related to neurologic manifestations, including seizures and mental retardation. Belongs to the aldehyde dehydrogenase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Amino Acid Metabolism - alanine, aspartate and glutamate; Mitochondrial; Amino Acid Metabolism - arginine and proline; Oxidoreductase; EC 1.2.1.88

Chromosomal Location of Human Ortholog: 1p36

Cellular Component: mitochondrial matrix

Molecular Function: 1-pyrroline-5-carboxylate dehydrogenase activity; aldehyde dehydrogenase (NAD) activity; electron carrier activity; identical protein binding

Biological Process: 4-hydroxyproline catabolic process; proline catabolic process; proline metabolic process

Disease: Hyperprolinemia, Type Ii

Research Articles on ALDH4A1

Similar Products

Product Notes

The ALDH4A1 aldh4a1 (Catalog #AAA1265906) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctgc cggcgcccgc gctccgccgc gccctgctgt cccgcccctg gaccggggcc ggcctgcggt ggaagcacac ctcctccctg aaggtggcca acgagcccgt cttagccttc acgcagggca gccctgagcg agatgccctg caaaaggcct tgaaggacct gaagggccgg atggaagcca tcccatgcgt ggtgggggat gaggaggtgt ggacgtcgga cgtgcagtac caagtgtcgc cttttaacca tggacataag gtggccaagt tctgttatgc agacaagagc ctgctcaaca aagccattga ggctgccctg gctgcccgga aagagtggga cctgaagcct attgcagacc gggcccagat cttcctgaag gcggcagaca tgctgagtgg gccgcgcagg gctgagatcc tcgccaagac catggtggga cagggtaaga ccgtgatcca agcggagatt gacgctgcag cggaactcat cgacttcttc cggttcaatg ccaagtatgc ggtggagctg gaggggcagc agcccatcag cgtgcccccg agcaccaaca gcacggtgta ccggggtctg gagggcttcg tggcggccat ctcgcccttt aacttcactg caatcggcgg caacctggcg ggggcaccgg ccctgatggg caacgtggtc ctatggaagc ccagtgacac tgccatgctg gccagctatg ctgtctaccg catccttcgg gaggctggcc tgccccccaa catcatccag tttgtgccag ctgatgggcc cctatttggg gacactgtca ccagctcaga gcacctctgt ggcatcaact tcacaggcag tgtgcccacc ttcaaacacc tgtggaagca ggtggcccag aacctggacc ggttccacac cttcccacgc ctggctggag agtgcggcgg aaagaacttc cacttcgtgc accgctcggc cgacgtggag agcgtggtga gcgggaccct ccgctcagcc ttcgagtacg gtggccagaa gtgttccgcc tgctcgcgtc tctacgtgcc gcactcgctg tggccgcaga tcaaagggcg gctgctggag gagcacagtc ggatcaaagt gggcgaccct gcagaggatt ttgggacctt cttctctgca gtgattgatg ccaagtcctt tgcccgtatc aagaagtggc tggagcacgc acgctcctca cccagcctca ccatcctggc cgggggcaag tgtgatgact ccgtgggcta ctttgtggag ccctgcatcg tggagagcaa ggaccctcag gagcccatca tgaaggagga gatcttcggg cctgtactgt ctgtgtacgt ctacccggat gacaagtaca aggagacgct gcagctgatt gacagcacca ccagctatgg cctcacgggg gcagtgttct cccaggataa ggacgtcgtg caggaggcca caaaggtgct gaggaatgct gccggcaact tctacatcaa cgacaagtcc actggctcga tagtgggcca gcagcccttt gggggggccc gagcctctgg aaccaatgac aagccagggg gcccacacta catcctgcgc tggacgtcgc cgcaggtcat caaggagaca cataagcccc tgggggactg gagctacgcg tacatgcagt ga. It is sometimes possible for the material contained within the vial of "ALDH4A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.