Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCL24 cdna clone

CCL24 cDNA Clone

Gene Names
CCL24; Ckb-6; MPIF2; MPIF-2; SCYA24
Synonyms
CCL24; CCL24 cDNA Clone; CCL24 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaggcctgatgaccatagtaaccagccttctgttccttggtgtctgtgcccaccacatcatccctacgggctctgtggtcatcccctctccctgctgcatgttctttgtttccaagagaattcctgagaaccgagtggtcagctaccagctgtccagcaggagcacatgcctcaaggcaggagtgatcttcaccaccaagaagggccagcagttctgtggcgaccccaagcaggagtgggtccagaggtacatgaagaacctggacgccaagcagaagaaggcttcccctagggccagggcagtggctgtcaagggccctgtccagagatatcctggcaaccaaaccacctgctaa
Sequence Length
360
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,134 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) ligand 24, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine ligand 24
NCBI Official Symbol
CCL24
NCBI Official Synonym Symbols
Ckb-6; MPIF2; MPIF-2; SCYA24
NCBI Protein Information
C-C motif chemokine 24
UniProt Protein Name
C-C motif chemokine 24
Protein Family
UniProt Gene Name
CCL24
UniProt Synonym Gene Names
MPIF2; SCYA24; MPIF-2
UniProt Entry Name
CCL24_HUMAN

NCBI Description

This gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity on resting T lymphocytes, a minimal activity on neutrophils, and is negative on monocytes and activated T lymphocytes. The protein is also a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. [provided by RefSeq, Jul 2008]

Uniprot Description

CCL24: Chemotactic for resting T-lymphocytes, and eosinophils. Has lower chemotactic activity for neutrophils but none for monocytes and activated lymphocytes. Is a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. Binds to CCR3. Belongs to the intercrine beta (chemokine CC) family.

Protein type: Motility/polarity/chemotaxis; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 7q11.23

Cellular Component: extracellular space

Molecular Function: CCR chemokine receptor binding; chemokine activity

Biological Process: cell-cell signaling; chemotaxis; cytoskeleton organization and biogenesis; eosinophil chemotaxis; G-protein coupled receptor protein signaling pathway; immune response; lymphocyte chemotaxis; monocyte chemotaxis; neutrophil chemotaxis; positive regulation of actin filament polymerization; positive regulation of cell migration; positive regulation of endothelial cell proliferation; positive regulation of GTPase activity; positive regulation of inflammatory response; regulation of cell shape; signal transduction

Research Articles on CCL24

Similar Products

Product Notes

The CCL24 ccl24 (Catalog #AAA1265894) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggcc tgatgaccat agtaaccagc cttctgttcc ttggtgtctg tgcccaccac atcatcccta cgggctctgt ggtcatcccc tctccctgct gcatgttctt tgtttccaag agaattcctg agaaccgagt ggtcagctac cagctgtcca gcaggagcac atgcctcaag gcaggagtga tcttcaccac caagaagggc cagcagttct gtggcgaccc caagcaggag tgggtccaga ggtacatgaa gaacctggac gccaagcaga agaaggcttc ccctagggcc agggcagtgg ctgtcaaggg ccctgtccag agatatcctg gcaaccaaac cacctgctaa. It is sometimes possible for the material contained within the vial of "CCL24, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.