Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HCCS cdna clone

HCCS cDNA Clone

Gene Names
HCCS; MLS; CCHL; MCOPS7; LSDMCA1
Synonyms
HCCS; HCCS cDNA Clone; HCCS cdna clone
Ordering
For Research Use Only!
Sequence
atgggtttgtctccatctgctcctgctgttgcagttcaggcctcaaatgcttcagcgtccccaccttcaggatgcccgatgcatgaagggaaaatgaaaggctgtccagtgaatacagagccatctggcccaacctgtgagaagaaaacatactctgtgcctgcccaccaggaacgcgcctatgagtacgtggagtgtcccattaggggcactgcggctgagaataaggagaacctagatccttcaaatctgatgccaccaccaaatcaaacaccagctccagatcagccatttgcattgtctactgtcagagaagagtcatccattccgagagcagattcagagaaaaagtgggtttacccttctgagcagatgttctggaatgcaatgttaaagaaagggtggaagtggaaggatgaggatatcagtcagaaggatatgtataatatcattagaattcacaatcagaataacgagcaggcttggaaggagattttgaagtgggaagcccttcatgctgcagagtgtccttgtggtccatcattgatccggtttggagggaaagcaaaagagtattcaccaagggcacgaattcgttcctggatggggtatgagttgccttttgataggcacgattggatcataaaccgttgcgggacagaagttagatatgtgattgattattatgatggtggtgaagtcaacaaggactaccagttcaccatcctggacgtccgtcctgccttagattcactttcggcagtatgggacagaatgaaagtcgcttggtggcgttggacctcgtaa
Sequence Length
807
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,602 Da
NCBI Official Full Name
Homo sapiens holocytochrome c synthase (cytochrome c heme-lyase), mRNA
NCBI Official Synonym Full Names
holocytochrome c synthase
NCBI Official Symbol
HCCS
NCBI Official Synonym Symbols
MLS; CCHL; MCOPS7; LSDMCA1
NCBI Protein Information
cytochrome c-type heme lyase
UniProt Protein Name
Cytochrome c-type heme lyase
UniProt Gene Name
HCCS
UniProt Synonym Gene Names
CCHL; CCHL
UniProt Entry Name
CCHL_HUMAN

NCBI Description

The protein encoded by this gene is an enzyme that covalently links a heme group to the apoprotein of cytochrome c. Defects in this gene are a cause of microphthalmia syndromic type 7 (MCOPS7). Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2010]

Uniprot Description

HCCS: Links covalently the heme group to the apoprotein of cytochrome c. Defects in HCCS are a cause of microphthalmia syndromic type 7 (MCOPS7); also known as microphthalmia with linear skin defects (MLS) or MIDAS syndrome. Microphthalmia is a clinically heterogeneous disorder of eye formation, ranging from small size of a single eye TO complete bilateral absence of ocular tissues (anophthalmia). In many cases, microphthalmia/anophthalmia occurs in association with syndromes that include non-ocular abnormalities. MCOPS7 is a disorder characterized by unilateral or bilateral microphthalmia, linear skin defects in affected females, and in utero lethality for males. Skin defects are limited to the face and neck, consisting of areas of aplastic skin that heal with age to form hyperpigmented areas. Additional features in female patients include agenesis of the corpus callosum, sclerocornea, chorioretinal abnormalities, infantile seizures, congenital heart defect, mental retardation, and diaphragmatic hernia. Belongs to the cytochrome c-type heme lyase family.

Protein type: EC 4.4.1.17; Lyase; Cofactor and Vitamin Metabolism - porphyrin and chlorophyll; Mitochondrial

Chromosomal Location of Human Ortholog: Xp22.3

Cellular Component: mitochondrion

Biological Process: organ morphogenesis

Disease: Microphthalmia, Syndromic 7

Research Articles on HCCS

Similar Products

Product Notes

The HCCS hccs (Catalog #AAA1265814) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtttgt ctccatctgc tcctgctgtt gcagttcagg cctcaaatgc ttcagcgtcc ccaccttcag gatgcccgat gcatgaaggg aaaatgaaag gctgtccagt gaatacagag ccatctggcc caacctgtga gaagaaaaca tactctgtgc ctgcccacca ggaacgcgcc tatgagtacg tggagtgtcc cattaggggc actgcggctg agaataagga gaacctagat ccttcaaatc tgatgccacc accaaatcaa acaccagctc cagatcagcc atttgcattg tctactgtca gagaagagtc atccattccg agagcagatt cagagaaaaa gtgggtttac ccttctgagc agatgttctg gaatgcaatg ttaaagaaag ggtggaagtg gaaggatgag gatatcagtc agaaggatat gtataatatc attagaattc acaatcagaa taacgagcag gcttggaagg agattttgaa gtgggaagcc cttcatgctg cagagtgtcc ttgtggtcca tcattgatcc ggtttggagg gaaagcaaaa gagtattcac caagggcacg aattcgttcc tggatggggt atgagttgcc ttttgatagg cacgattgga tcataaaccg ttgcgggaca gaagttagat atgtgattga ttattatgat ggtggtgaag tcaacaagga ctaccagttc accatcctgg acgtccgtcc tgccttagat tcactttcgg cagtatggga cagaatgaaa gtcgcttggt ggcgttggac ctcgtaa. It is sometimes possible for the material contained within the vial of "HCCS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.