Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PHF7 cdna clone

PHF7 cDNA Clone

Gene Names
PHF7; HSPC045; HSPC226; NYD-SP6
Synonyms
PHF7; PHF7 cDNA Clone; PHF7 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagactgtaaaagaaaagaaggaatgccagagattgagaaaatctgccaagactaggagggtaacccagaggaaaccgtcttcagggcctgtttgctggctatgccttcgagaacctggggatcccgaaaaattaggggaatttcttcagaaagacaatatcagcgtgcattatttctgtcttatcttatctagtaagctgcctcagaggggccagtccaacagaggtttccatggatttctgcctgaagacatcaaaaaggaggcagcccgggcttctaggaagatctgctttgtgtgcaagaaaaagggagctgctatcaactgccagaaggatcagtgcctcagaaacttccatctgccttgtggccaagaaaggggttgcctttcacaattttttggagagtacaaatcattttgtgacaaacatcgcccaacacagaacatccaacatgggcatgtgggggaggaaagctgcatcttatgttgtgaagacttatcccaacagagtgttgagaacatccagagcccgtgttgtagtcaagccatctaccaccgcaagtgcatacagaaatatgcccacacatcagcaaagcatttcttcaaatgtccacagtgtaacaatcgaaaagagtttcctcaagaaatgctgagaatgggaattcatattccagacagagatgctgcctgggaactcgagccaggggctttctcagacttatatcagcgctatcagcactgtgatgcccccatctgtctgtatgaacaaggcagagacagctttgaggatgaagggaggtggtgcctcattctgtgtgctacatgcggatcccacggaacccacagggactgctcctctcttagatctaacagtaagaaatgggagtgtgaggagtgttcacctgctgcagccacagactacatacctgaaaactcaggggacatcccttgctgcagcagcaccttccaccctgaggaacatttctgcagagacaacaccttggaagagaatccgggcctttcttggactgattggccagaaccttccttattagaaaagccagagtcctctcgtggcaggaggagctactcctggaggtccaagggtgtcagaatcactaacagctgcaaaaaatccaagtaa
Sequence Length
1146
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,259 Da
NCBI Official Full Name
Homo sapiens PHD finger protein 7, mRNA
NCBI Official Synonym Full Names
PHD finger protein 7
NCBI Official Symbol
PHF7
NCBI Official Synonym Symbols
HSPC045; HSPC226; NYD-SP6
NCBI Protein Information
PHD finger protein 7
UniProt Protein Name
PHD finger protein 7
Protein Family
UniProt Gene Name
PHF7
UniProt Entry Name
PHF7_HUMAN

NCBI Description

Spermatogenesis is a complex process regulated by extracellular and intracellular factors as well as cellular interactions among interstitial cells of the testis, Sertoli cells, and germ cells. This gene is expressed in the testis in Sertoli cells but not germ cells. The protein encoded by this gene contains plant homeodomain (PHD) finger domains, also known as leukemia associated protein (LAP) domains, believed to be involved in transcriptional regulation. The protein, which localizes to the nucleus of transfected cells, has been implicated in the transcriptional regulation of spermatogenesis. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]

Uniprot Description

PHF7: May play a role in spermatogenesis.

Protein type: Ubiquitin conjugating system; Cell development/differentiation

Chromosomal Location of Human Ortholog: 3p21.1

Cellular Component: microtubule organizing center; nucleoplasm; nucleus

Molecular Function: protein binding

Research Articles on PHF7

Similar Products

Product Notes

The PHF7 phf7 (Catalog #AAA1265809) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagactg taaaagaaaa gaaggaatgc cagagattga gaaaatctgc caagactagg agggtaaccc agaggaaacc gtcttcaggg cctgtttgct ggctatgcct tcgagaacct ggggatcccg aaaaattagg ggaatttctt cagaaagaca atatcagcgt gcattatttc tgtcttatct tatctagtaa gctgcctcag aggggccagt ccaacagagg tttccatgga tttctgcctg aagacatcaa aaaggaggca gcccgggctt ctaggaagat ctgctttgtg tgcaagaaaa agggagctgc tatcaactgc cagaaggatc agtgcctcag aaacttccat ctgccttgtg gccaagaaag gggttgcctt tcacaatttt ttggagagta caaatcattt tgtgacaaac atcgcccaac acagaacatc caacatgggc atgtggggga ggaaagctgc atcttatgtt gtgaagactt atcccaacag agtgttgaga acatccagag cccgtgttgt agtcaagcca tctaccaccg caagtgcata cagaaatatg cccacacatc agcaaagcat ttcttcaaat gtccacagtg taacaatcga aaagagtttc ctcaagaaat gctgagaatg ggaattcata ttccagacag agatgctgcc tgggaactcg agccaggggc tttctcagac ttatatcagc gctatcagca ctgtgatgcc cccatctgtc tgtatgaaca aggcagagac agctttgagg atgaagggag gtggtgcctc attctgtgtg ctacatgcgg atcccacgga acccacaggg actgctcctc tcttagatct aacagtaaga aatgggagtg tgaggagtgt tcacctgctg cagccacaga ctacatacct gaaaactcag gggacatccc ttgctgcagc agcaccttcc accctgagga acatttctgc agagacaaca ccttggaaga gaatccgggc ctttcttgga ctgattggcc agaaccttcc ttattagaaa agccagagtc ctctcgtggc aggaggagct actcctggag gtccaagggt gtcagaatca ctaacagctg caaaaaatcc aagtaa. It is sometimes possible for the material contained within the vial of "PHF7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.