Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL17B cdna clone

IL17B cDNA Clone

Gene Names
IL17B; NIRF; IL-20; IL-17B; ZCYTO7
Synonyms
IL17B; IL17B cDNA Clone; IL17B cdna clone
Ordering
For Research Use Only!
Sequence
ATGGACTGGCCTCACAACCTGCTGTTTCTTCTTACCATTTCCATCTTCCTGGGGCTGGGCCAGCCCAGGAGCCCCAAAAGCAAGAGGAAGGGGCAAGGGCGGCCTGGGCCCCTGGCCCCTGGCCCTCACCAGGTGCCACTGGACCTGGTGTCACGGATGAAACCGTATGCCCGCATGGAGGAGTATGAGAGGAACATCGAGGAGATGGTGGCCCAGCTGAGGAACAGCTCAGAGCTGGCCCAGAGAAAGTGTGAGGTCAACTTGCAGCTGTGGATGTCCAACAAGAGGAGCCTGTCTCCCTGGGGCTACAGCATCAACCACGACCCCAGCCGTATCCCCGTGGACCTGCCGGAGGCACGGTGCCTGTGTCTGGGCTGTGTGAACCCCTTCACCATGCAGGAGGACCGCAGCATGGTGAGCGTGCCGGTGTTCAGCCAGGTTCCTGTGCGCCGCCGCCTCTGCCCGCCACCGCCCCGCACAGGGCCTTGCCGCCAGCGCGCAGTCATGGAGACCATCGCTGTGGGCTGCACCTGCATCTTCTGA
Sequence Length
543
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,437 Da
NCBI Official Full Name
Homo sapiens interleukin 17B, mRNA
NCBI Official Synonym Full Names
interleukin 17B
NCBI Official Symbol
IL17B
NCBI Official Synonym Symbols
NIRF; IL-20; IL-17B; ZCYTO7
NCBI Protein Information
interleukin-17B
UniProt Protein Name
Interleukin-17B
Protein Family
UniProt Gene Name
IL17B
UniProt Synonym Gene Names
IL20; NIRF; ZCYTO7; IL-17B; IL-20
UniProt Entry Name
IL17B_HUMAN

NCBI Description

The protein encoded by this gene is a T cell-derived cytokine that shares sequence similarity with IL17. This cytokine was reported to stimulate the release of TNF alpha (TNF) and IL1 beta (IL1B) from a monocytic cell line. Immunohistochemical analysis of several nerve tissues indicated that this cytokine is primarily localized to neuronal cell bodies. Alternative splicing results in multiple splice variants. [provided by RefSeq, Dec 2015]

Uniprot Description

IL17B: Stimulates the release of tumor necrosis factor alpha and IL-1-beta from the monocytic cell line THP-1. Belongs to the IL-17 family.

Protein type: Secreted, signal peptide; Cytokine; Secreted

Chromosomal Location of Human Ortholog: 5q33.1

Cellular Component: extracellular space

Molecular Function: hematopoietin/interferon-class (D200-domain) cytokine receptor binding

Biological Process: cell surface receptor linked signal transduction; cell-cell signaling; immune response; inflammatory response

Research Articles on IL17B

Similar Products

Product Notes

The IL17B il17b (Catalog #AAA1265752) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGACTGGC CTCACAACCT GCTGTTTCTT CTTACCATTT CCATCTTCCT GGGGCTGGGC CAGCCCAGGA GCCCCAAAAG CAAGAGGAAG GGGCAAGGGC GGCCTGGGCC CCTGGCCCCT GGCCCTCACC AGGTGCCACT GGACCTGGTG TCACGGATGA AACCGTATGC CCGCATGGAG GAGTATGAGA GGAACATCGA GGAGATGGTG GCCCAGCTGA GGAACAGCTC AGAGCTGGCC CAGAGAAAGT GTGAGGTCAA CTTGCAGCTG TGGATGTCCA ACAAGAGGAG CCTGTCTCCC TGGGGCTACA GCATCAACCA CGACCCCAGC CGTATCCCCG TGGACCTGCC GGAGGCACGG TGCCTGTGTC TGGGCTGTGT GAACCCCTTC ACCATGCAGG AGGACCGCAG CATGGTGAGC GTGCCGGTGT TCAGCCAGGT TCCTGTGCGC CGCCGCCTCT GCCCGCCACC GCCCCGCACA GGGCCTTGCC GCCAGCGCGC AGTCATGGAG ACCATCGCTG TGGGCTGCAC CTGCATCTTC TGA. It is sometimes possible for the material contained within the vial of "IL17B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.