Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CREB3L4 cdna clone

CREB3L4 cDNA Clone

Gene Names
CREB3L4; JAL; hJAL; ATCE1; CREB3; CREB4; AIBZIP
Synonyms
CREB3L4; CREB3L4 cDNA Clone; CREB3L4 cdna clone
Ordering
For Research Use Only!
Sequence
atggatctcggaatccctgacctgctggacgcgtggctggagcccccagaggatatcttctcgacaggatccgtcctggagctgggactccactgcccccctccagaggttccggtaactaggctacaggaacagggactgcaaggctggaagtccggtggggaccgtggctgtggccttcaagagagtgagcctgaagatttcttgaagcttttcattgatcccaatgaggtgtactgctcagaagcatctcctggcagtgacagtggcatctctgaggacccctgccatccagacagtccccctgcccccagggcaaccagttctcctatgctctatgaggttgtctatgaggcaggggccctggagaggatgcagggggaaactgggccaaatgtaggccttatctccatccagctagatcagtggagcccagcatttatggtgcctgattcctgcatggtcagtgagctgccctttgatgctcatgcccacatcctgcccagagcaggcaccgtagccccagtgccctgtacaaccctgctgccctgtcaaaccctgttcctgaccgatgaggagaagcgtctgctggggcaggaaggggtttccctgccctctcacctgcccctcaccaaggcagaggagagggtcctcaagaaggtcaggaggaaaatccgtaacaagcagtcagctcaggacagtcggcggcggaagaaggagtacattgatgggctggagagcagggtggcagcctgttctgcacagaaccaagaattacagaaaaaagtccaggagctggagaggcacaacatctccttggtagctcagctccgccagctgcagacgctaattgctcaaacttccaacaaagctgcccagaccagcacttgtgttttgattcttcttttttccctggctctcatcatcctgcccagcttcagtccattccagagtcgaccagaagctgggtctgaggattaccagcctcacggagtgacttccagaaatatcctgacccacaaggacgtaacagaaaatctggagacccaagtggtagagtccagactgagggagccacctggagccaaggatgcaaatggctcaacaaggacactgcttgagaagatgggagggaagccaagacccagtgggcgcatccggtccgtgctgcatgcagatgagatgtga
Sequence Length
1188
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,275 Da
NCBI Official Full Name
Homo sapiens cAMP responsive element binding protein 3-like 4, mRNA
NCBI Official Synonym Full Names
cAMP responsive element binding protein 3 like 4
NCBI Official Symbol
CREB3L4
NCBI Official Synonym Symbols
JAL; hJAL; ATCE1; CREB3; CREB4; AIBZIP
NCBI Protein Information
cyclic AMP-responsive element-binding protein 3-like protein 4
UniProt Protein Name
Cyclic AMP-responsive element-binding protein 3-like protein 4
UniProt Gene Name
CREB3L4
UniProt Synonym Gene Names
AIBZIP; CREB4; JAL; cAMP-responsive element-binding protein 3-like protein 4; AIbZIP; ATCE1; CREB-4; cAMP-responsive element-binding protein 4; Tisp40
UniProt Entry Name
CR3L4_HUMAN

NCBI Description

This gene encodes a CREB (cAMP responsive element binding) protein with a transmembrane domain which localizes it to the ER membrane. The encoded protein is a transcriptional activator which contains a dimerization domain, and this protein may function in a number of processing pathways including protein processing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

Uniprot Description

CREB3L4: Transcriptional activator that may play a role in the unfolded protein response. Binds to the UPR element (UPRE) but not to CRE element. Preferentially binds DNA with to the consensus sequence 5'-T[GT]ACGT[GA][GT]-3' and has transcriptional activation activity from UPRE. Binds to NF-kappa-B site and has transcriptional activation activity from NF-kappa-B-containing regulatory elements. Belongs to the bZIP family. ATF subfamily.

Protein type: Transcription factor; Endoplasmic reticulum; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q21.3

Cellular Component: endoplasmic reticulum; Golgi apparatus

Biological Process: positive regulation of transcription from RNA polymerase II promoter

Research Articles on CREB3L4

Similar Products

Product Notes

The CREB3L4 creb3l4 (Catalog #AAA1265739) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatctcg gaatccctga cctgctggac gcgtggctgg agcccccaga ggatatcttc tcgacaggat ccgtcctgga gctgggactc cactgccccc ctccagaggt tccggtaact aggctacagg aacagggact gcaaggctgg aagtccggtg gggaccgtgg ctgtggcctt caagagagtg agcctgaaga tttcttgaag cttttcattg atcccaatga ggtgtactgc tcagaagcat ctcctggcag tgacagtggc atctctgagg acccctgcca tccagacagt ccccctgccc ccagggcaac cagttctcct atgctctatg aggttgtcta tgaggcaggg gccctggaga ggatgcaggg ggaaactggg ccaaatgtag gccttatctc catccagcta gatcagtgga gcccagcatt tatggtgcct gattcctgca tggtcagtga gctgcccttt gatgctcatg cccacatcct gcccagagca ggcaccgtag ccccagtgcc ctgtacaacc ctgctgccct gtcaaaccct gttcctgacc gatgaggaga agcgtctgct ggggcaggaa ggggtttccc tgccctctca cctgcccctc accaaggcag aggagagggt cctcaagaag gtcaggagga aaatccgtaa caagcagtca gctcaggaca gtcggcggcg gaagaaggag tacattgatg ggctggagag cagggtggca gcctgttctg cacagaacca agaattacag aaaaaagtcc aggagctgga gaggcacaac atctccttgg tagctcagct ccgccagctg cagacgctaa ttgctcaaac ttccaacaaa gctgcccaga ccagcacttg tgttttgatt cttctttttt ccctggctct catcatcctg cccagcttca gtccattcca gagtcgacca gaagctgggt ctgaggatta ccagcctcac ggagtgactt ccagaaatat cctgacccac aaggacgtaa cagaaaatct ggagacccaa gtggtagagt ccagactgag ggagccacct ggagccaagg atgcaaatgg ctcaacaagg acactgcttg agaagatggg agggaagcca agacccagtg ggcgcatccg gtccgtgctg catgcagatg agatgtga. It is sometimes possible for the material contained within the vial of "CREB3L4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.