Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MMGT1 cdna clone

MMGT1 cDNA Clone

Gene Names
MMGT1; EMC5; TMEM32
Synonyms
MMGT1; MMGT1 cDNA Clone; MMGT1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgccgtcgctgtggaaggggctggtgggcatcggtctctttgccctagcccacgccgccttttccgctgcgcagcatcgttcttatatgcgattaacagaaaaagaagatgaatcactgccaatagatatagttcttcagacacttctggcctttgcagttacctgttacggtatagttcatattgcaggagagtttaaagacatggatgccacttcagaactgaaaaataagacatttgatacgttaaggaatcacccatccttttatgtatttaatcatcgtggtcgagtacttttccggccttcggatacagcaaattcttcaaaccaagatgcattgtcctctaacacatcattgaagttacgaaaactcgaatcactgcgtcgttaa
Sequence Length
396
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,881 Da
NCBI Official Full Name
Homo sapiens membrane magnesium transporter 1, mRNA
NCBI Official Synonym Full Names
membrane magnesium transporter 1
NCBI Official Symbol
MMGT1
NCBI Official Synonym Symbols
EMC5; TMEM32
NCBI Protein Information
membrane magnesium transporter 1
UniProt Protein Name
Membrane magnesium transporter 1
UniProt Gene Name
MMGT1
UniProt Synonym Gene Names
EMC5; TMEM32
UniProt Entry Name
MMGT1_HUMAN

Uniprot Description

TMEM32: Mediates Mg(2+) transport. Belongs to the membrane magnesium transporter (TC 1.A.67) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Transporter

Chromosomal Location of Human Ortholog: Xq26.3

Cellular Component: early endosome; Golgi apparatus; integral to membrane; membrane; plasma membrane

Molecular Function: inorganic cation transmembrane transporter activity; magnesium ion transmembrane transporter activity

Biological Process: magnesium ion transport

Similar Products

Product Notes

The MMGT1 mmgt1 (Catalog #AAA1265728) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgccgt cgctgtggaa ggggctggtg ggcatcggtc tctttgccct agcccacgcc gccttttccg ctgcgcagca tcgttcttat atgcgattaa cagaaaaaga agatgaatca ctgccaatag atatagttct tcagacactt ctggcctttg cagttacctg ttacggtata gttcatattg caggagagtt taaagacatg gatgccactt cagaactgaa aaataagaca tttgatacgt taaggaatca cccatccttt tatgtattta atcatcgtgg tcgagtactt ttccggcctt cggatacagc aaattcttca aaccaagatg cattgtcctc taacacatca ttgaagttac gaaaactcga atcactgcgt cgttaa. It is sometimes possible for the material contained within the vial of "MMGT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.