GCC1 cdna clone
GCC1 cDNA Clone
Gene Names
GCC1; GCC1P; GCC88
Synonyms
GCC1; GCC1 cDNA Clone; GCC1 cdna clone
Sequence
atggagaagtttgggatgaatttcgggggcggcccgagcaagaaggacttgctggagactatagagacccagaagaagcagcttctccagtaccaggcacggctcaaggatgtggtccgtgcctataaaagcctgctgaaggagaaagaggcattagaggccagcatcaaggtgctgtcggtatcccacgaggcagatgtgggcctcgcaggtgtccagcttccaggcctcacctttcctgactctgtggatgaccggtgctccactcacagcgaggatagcactgggaccgccactagcttggatactgcggccagtctcaccagcaccaagggtgagtttggggtagaagatgacagaccggcccgtggaccaccacctccaaagtccgaagaggccagttggtccgagagtggcgttagcagtagcagtggggatgggccatttgcaggtggggaggtggacaaaagactgcaccagctgaagactcagttggctactttgaccagttctttggctacagtcactcaggagaagtcccgcatggaggcttcttacttggctgacaagaaaaagatgaaacaggacttagaggatgccagtaacaaggcggaggaggagagggcccgcctggagggagaattgaaggggctgcaggagcaaatagcagaaaccaaagcccggcttatcacgcagcagcatgatcgggcccaagagcagagtgaccatgccttgatgctgcgtgagctccagaagctgctgcaggaggagaggacccagcgccaggacttggagcttaggttagaagagacccgagaagccttggcaggacgagcatatgcagctgaacagatggaaggatttgaactgcagaccaagcagctgacccgtgaggtggaggagctgaaaagtgaactgcaggccattcgagatgagaagaatcagccagatccccggctgcaagaacttcaggaagaggctgcccgccttaagagccatttccaggctcagttacagcaggaaatgagaaagacagctcttgcagaggatcaactccgtcagcaatctcaggtagaagaacagagggtggcagccctggagaatcaaatatccgaggtgtctgagctgctaggcacctacgagaaagccaagcagaaggaccagctggccattcagaagctgaaggagcgcattctgcagctggacctggagaacaagacactggctctagcagcctccagcaggtcccctttagacagccatggagaggagtccagtctggatgtcaatgtcctgaaagataagatggagaagctgaagaggctgctgcaggttgcggccaggaaaagccaggtgaccctggatgtggagaagctctgtgacctggagataatgcccagctcggaggctgctgatggggagaaggctactgcactctattaccaacaggagctgaaacagctgaaggaagagtttgagaggtacaagatgagagcccaggttgtcctcaaaagcaagaataccaaagatggtaacctgggaaaggagctggaggcagcccaggaacagcttgcagagctgaaggagaagtatatttccctgcggctctcctgcgaggagctggagcaccaacaccagcaggaggctgatgactggaagcaggagctggcccggctgcagcagctccaccggcaggagctggagcggtgccagctggacttcagggaccgcacactgaaactggaggaggagctgcacaagcagcgggatcgtgccctagctgtgctcaccgagaaggacttggaactggagcaactgcgttctgtggccttggcctctgggctgccaggacgcagaagtcctgtgggtggtggcggtcctggggacccagctgacacatcatcctctgatagcctgacccaagcattacaacttgcagcggccaatgagcccactttctttctgtacgctgagcaactggcccgcaaggaggtggagatcacatcactgaggaagcagaagcacaggctggaggtcgaggtgcatcagctgcaggatcggctgctggaggagggcgaacggcatcgtgaggaggttgcagccctgcagagccacatcgaaaagaacatcagggaccagagcagggagggagccaatctggagtacctcaaaaacatcatctaccgcttcctgaccttacctgactccctgggccgccagcagactctcacagccatactgactatcttgcacttcagtccagaggagaaacaagtgataatgcgactcccaaccagtgccagctggtggccttctggcaagagatga
Sequence Length
2328
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
87,811 Da
NCBI Official Full Name
Homo sapiens GRIP and coiled-coil domain containing 1, mRNA
NCBI Official Synonym Full Names
GRIP and coiled-coil domain containing 1
NCBI Official Symbol
GCC1
NCBI Official Synonym Symbols
GCC1P; GCC88
NCBI Protein Information
GRIP and coiled-coil domain-containing protein 1
UniProt Protein Name
GRIP and coiled-coil domain-containing protein 1
Protein Family
UniProt Gene Name
GCC1
UniProt Entry Name
GCC1_HUMAN
NCBI Description
The protein encoded by this gene is a peripheral membrane protein. It is sensitive to brefeldin A. This encoded protein contains a GRIP domain which is thought to be used in targeting. It may play a role in the organization of trans-Golgi network subcompartment involved with membrane transport. [provided by RefSeq, Jul 2008]
Uniprot Description
GCC1: Probably involved in maintaining Golgi structure.
Protein type: Vesicle
Chromosomal Location of Human Ortholog: 7q32.1
Cellular Component: cytoplasm; cytosol; Golgi apparatus; plasma membrane
Molecular Function: protein binding
Research Articles on GCC1
Similar Products
Product Notes
The GCC1 gcc1 (Catalog #AAA1265696) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaagt ttgggatgaa tttcgggggc ggcccgagca agaaggactt gctggagact atagagaccc agaagaagca gcttctccag taccaggcac ggctcaagga tgtggtccgt gcctataaaa gcctgctgaa ggagaaagag gcattagagg ccagcatcaa ggtgctgtcg gtatcccacg aggcagatgt gggcctcgca ggtgtccagc ttccaggcct cacctttcct gactctgtgg atgaccggtg ctccactcac agcgaggata gcactgggac cgccactagc ttggatactg cggccagtct caccagcacc aagggtgagt ttggggtaga agatgacaga ccggcccgtg gaccaccacc tccaaagtcc gaagaggcca gttggtccga gagtggcgtt agcagtagca gtggggatgg gccatttgca ggtggggagg tggacaaaag actgcaccag ctgaagactc agttggctac tttgaccagt tctttggcta cagtcactca ggagaagtcc cgcatggagg cttcttactt ggctgacaag aaaaagatga aacaggactt agaggatgcc agtaacaagg cggaggagga gagggcccgc ctggagggag aattgaaggg gctgcaggag caaatagcag aaaccaaagc ccggcttatc acgcagcagc atgatcgggc ccaagagcag agtgaccatg ccttgatgct gcgtgagctc cagaagctgc tgcaggagga gaggacccag cgccaggact tggagcttag gttagaagag acccgagaag ccttggcagg acgagcatat gcagctgaac agatggaagg atttgaactg cagaccaagc agctgacccg tgaggtggag gagctgaaaa gtgaactgca ggccattcga gatgagaaga atcagccaga tccccggctg caagaacttc aggaagaggc tgcccgcctt aagagccatt tccaggctca gttacagcag gaaatgagaa agacagctct tgcagaggat caactccgtc agcaatctca ggtagaagaa cagagggtgg cagccctgga gaatcaaata tccgaggtgt ctgagctgct aggcacctac gagaaagcca agcagaagga ccagctggcc attcagaagc tgaaggagcg cattctgcag ctggacctgg agaacaagac actggctcta gcagcctcca gcaggtcccc tttagacagc catggagagg agtccagtct ggatgtcaat gtcctgaaag ataagatgga gaagctgaag aggctgctgc aggttgcggc caggaaaagc caggtgaccc tggatgtgga gaagctctgt gacctggaga taatgcccag ctcggaggct gctgatgggg agaaggctac tgcactctat taccaacagg agctgaaaca gctgaaggaa gagtttgaga ggtacaagat gagagcccag gttgtcctca aaagcaagaa taccaaagat ggtaacctgg gaaaggagct ggaggcagcc caggaacagc ttgcagagct gaaggagaag tatatttccc tgcggctctc ctgcgaggag ctggagcacc aacaccagca ggaggctgat gactggaagc aggagctggc ccggctgcag cagctccacc ggcaggagct ggagcggtgc cagctggact tcagggaccg cacactgaaa ctggaggagg agctgcacaa gcagcgggat cgtgccctag ctgtgctcac cgagaaggac ttggaactgg agcaactgcg ttctgtggcc ttggcctctg ggctgccagg acgcagaagt cctgtgggtg gtggcggtcc tggggaccca gctgacacat catcctctga tagcctgacc caagcattac aacttgcagc ggccaatgag cccactttct ttctgtacgc tgagcaactg gcccgcaagg aggtggagat cacatcactg aggaagcaga agcacaggct ggaggtcgag gtgcatcagc tgcaggatcg gctgctggag gagggcgaac ggcatcgtga ggaggttgca gccctgcaga gccacatcga aaagaacatc agggaccaga gcagggaggg agccaatctg gagtacctca aaaacatcat ctaccgcttc ctgaccttac ctgactccct gggccgccag cagactctca cagccatact gactatcttg cacttcagtc cagaggagaa acaagtgata atgcgactcc caaccagtgc cagctggtgg ccttctggca agagatga. It is sometimes possible for the material contained within the vial of "GCC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
