APOBEC3D cdna clone

APOBEC3D cDNA Clone

Gene Names

APOBEC3D; A3D; ARP6; APOBEC3E; APOBEC3DE

Synonyms

APOBEC3D; APOBEC3D cDNA Clone; APOBEC3D cdna clone

Ordering
Cat. Num. AAA1265668 For Research Use Only!

Sequence

atgaatccacagatcagaaatccgatggagcggatgtatcgagacacattctacgacaactttgaaaacgaacccatcctctatggtcggagctacacttggctgtgctatgaagtgaaaataaagaggggccgctcaaatctcctttgggacacaggggtctttcgaggcccggtactacccaaacgtcagtcgaatcacaggcaggaggtgtatttccggtttgagaaccacgcagaaatgtgcttcttatcttggttctgtggcaaccgactgcctgctaacaggcgcttccagatcacctggtttgtatcatggaacccctgcctgccctgtgtggtgaaggtgaccaaattcttggctgagcaccccaatgtcaccctgaccatctctgccgcccgcctctactactaccgggatagagattggcggtgggtgctcctcaggctgcataaggcaggggcccgtgtgaagatcatggactatgaagactttgcatactgctgggaaaactttgtgtgcaatgaaggtcagccattcatgccttggtacaaattcgatgacaattatgcatccctgcaccgcacgctaaaggagattctcagaaacccgatggaggcaatgtacccacacatattctacttccactttaaaaacctactgaaagcctgtggtcggaacgaaagctggctgtgcttcaccatggaagttacaaagcaccactcagctgtcttccggaagaggggcgtcttccgaaaccaggtggatcctgagacccattgtcatgcagaaaggtgcttcctctcttggttctgtgacgacatactgtctcctaacacaaactacgaggtcacctggtacacatcttggagcccttgcccagagtgtgcaggggaggtggccgagttcctggccaggcacagcaacgtgaatctcaccatcttcaccgcccgcctctgctatttctgggatacagattaccaggaggggctctgcagcctgagtcaggaaggggcctccgtgaagatcatgggctacaaagattttgtatcttgttggaaaaactttgtgtacagtgatgatgagccattcaagccttggaagggactacaaaccaactttcgacttctgaaaagaaggctacgggagattctccagtga

Sequence Length

1161

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

16877535

NCBI GeneID

140564

Molecular Weight

46,598 Da

NCBI Official Full Name

Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D, mRNA

NCBI Official Synonym Full Names

apolipoprotein B mRNA editing enzyme catalytic subunit 3D

NCBI Official Symbol

APOBEC3D

NCBI Official Synonym Symbols

A3D; ARP6; APOBEC3E; APOBEC3DE

NCBI Protein Information

DNA dC->dU-editing enzyme APOBEC-3D

UniProt Protein Name

DNA dC->dU-editing enzyme APOBEC-3D

Protein Family

DNA dC->dU-editing enzyme

UniProt Gene Name

APOBEC3D

UniProt Synonym Gene Names

A3D

UniProt Entry Name

ABC3D_HUMAN

NCBI Description

This gene is a member of the cytidine deaminase gene family. It is one of a group of related genes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1 and inhibit retroviruses, such as HIV, by deaminating cytosine residues in nascent retroviral cDNA. [provided by RefSeq, Jul 2008]

Uniprot Description

APOBEC3D: Probable DNA cytidine deaminase involved in foreign DNA clearance. May provide cellular innate resistance to a specific panel of genetic invaders including endogenous retroelements and a subset of viruses. Belongs to the cytidine and deoxycytidylate deaminase family.

Protein type: EC 3.5.4.-; Hydrolase

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: cytoplasm

Biological Process: defense response to virus; negative regulation of retroviral genome replication

Research Articles on APOBEC3D

1. APOBEC3D/F and APOBEC3G fundamentally work as restriction factors against HIV-1 in vivo

Similar Products

Product Notes

The APOBEC3D apobec3d (Catalog #AAA1265668) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatccac agatcagaaa tccgatggag cggatgtatc gagacacatt ctacgacaac tttgaaaacg aacccatcct ctatggtcgg agctacactt ggctgtgcta tgaagtgaaa ataaagaggg gccgctcaaa tctcctttgg gacacagggg tctttcgagg cccggtacta cccaaacgtc agtcgaatca caggcaggag gtgtatttcc ggtttgagaa ccacgcagaa atgtgcttct tatcttggtt ctgtggcaac cgactgcctg ctaacaggcg cttccagatc acctggtttg tatcatggaa cccctgcctg ccctgtgtgg tgaaggtgac caaattcttg gctgagcacc ccaatgtcac cctgaccatc tctgccgccc gcctctacta ctaccgggat agagattggc ggtgggtgct cctcaggctg cataaggcag gggcccgtgt gaagatcatg gactatgaag actttgcata ctgctgggaa aactttgtgt gcaatgaagg tcagccattc atgccttggt acaaattcga tgacaattat gcatccctgc accgcacgct aaaggagatt ctcagaaacc cgatggaggc aatgtaccca cacatattct acttccactt taaaaaccta ctgaaagcct gtggtcggaa cgaaagctgg ctgtgcttca ccatggaagt tacaaagcac cactcagctg tcttccggaa gaggggcgtc ttccgaaacc aggtggatcc tgagacccat tgtcatgcag aaaggtgctt cctctcttgg ttctgtgacg acatactgtc tcctaacaca aactacgagg tcacctggta cacatcttgg agcccttgcc cagagtgtgc aggggaggtg gccgagttcc tggccaggca cagcaacgtg aatctcacca tcttcaccgc ccgcctctgc tatttctggg atacagatta ccaggagggg ctctgcagcc tgagtcagga aggggcctcc gtgaagatca tgggctacaa agattttgta tcttgttgga aaaactttgt gtacagtgat gatgagccat tcaagccttg gaagggacta caaaccaact ttcgacttct gaaaagaagg ctacgggaga ttctccagtg a. It is sometimes possible for the material contained within the vial of "APOBEC3D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

APOBEC3D cdna clone