NFkB, Consensus Oligonucleotide Peptide
NFkB, Consensus Oligonucleotide (NF-kB, Nuclear Factor kappa B)
Applications
Gel Super Shift Assay
Synonyms
NFkB; Consensus Oligonucleotide; Consensus Oligonucleotide (NF-kB; Nuclear Factor kappa B); Consensus Oligonucleotide peptide
Specificity
Binds NF B /c-Rel homodomeric and heterodimeric complexes.
Form/Format
Supplied as a liquid in 10mM Tris, 1mM EDTA, 200mM sodium chloride, 0.01% sodium azide. No stabilizing proteins added.
Applicable Applications for NFkB, Consensus Oligonucleotide peptide
Gel Shift Assay (GS/EMSA)
Application Notes
Suitable for use in Shift and Super Shift Assays.
Preparation and Storage
For long-term storage, aliquot to avoid repeated freezing and thawing and freeze at -70 degree C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap. Aliquots are stable for at least 12 months.
Related Product Information for NFkB, Consensus Oligonucleotide peptide
GTTGAGGGGACTTTCCCAGGC (top strand only KB consensus site in bold).
NFkB was originally identified as a factor that binds to the immunoglobulin kappa light chain enhancer in B cells. It was subsequently found in non-B cells in an inactive cytoplasmic form consisting of NFkB bound to IkB. NF-kB was originally identified as a heterodimeric DNA binding protein complex consisting of p65 (RelA) and p50 (NFKB1) subunits. Other identified subunits include p52, c-Rel, and RelB. The p65, cRel, and RelB subunits are responsible for transactivation. The p50 and p52 subunits possess DNA binding activity but limited ability to transactivate. p52 has been reported to form transcriptionally active heterodimers with the NFkB subunit p65, similar to p50/p65 heterodimers. The heterodimers of p52/p65 and p50/p65 are regulated by physical inactivation in the cytoplasm by an inhibitor called IkB-a. IkB-a binds to the p65 subunit, preventing nuclear localization and DNA binding. Low levels of p52 and p50 homodimers can also exist in cells.
NFkB was originally identified as a factor that binds to the immunoglobulin kappa light chain enhancer in B cells. It was subsequently found in non-B cells in an inactive cytoplasmic form consisting of NFkB bound to IkB. NF-kB was originally identified as a heterodimeric DNA binding protein complex consisting of p65 (RelA) and p50 (NFKB1) subunits. Other identified subunits include p52, c-Rel, and RelB. The p65, cRel, and RelB subunits are responsible for transactivation. The p50 and p52 subunits possess DNA binding activity but limited ability to transactivate. p52 has been reported to form transcriptionally active heterodimers with the NFkB subunit p65, similar to p50/p65 heterodimers. The heterodimers of p52/p65 and p50/p65 are regulated by physical inactivation in the cytoplasm by an inhibitor called IkB-a. IkB-a binds to the p65 subunit, preventing nuclear localization and DNA binding. Low levels of p52 and p50 homodimers can also exist in cells.
Product Categories/Family for NFkB, Consensus Oligonucleotide peptide
Similar Products
Product Notes
The NFkB, Consensus Oligonucleotide (Catalog #AAA658390) is a Peptide and is intended for research purposes only. The product is available for immediate purchase. AAA Biotech's NFkB, Consensus Oligonucleotide can be used in a range of immunoassay formats including, but not limited to, Gel Shift Assay (GS/EMSA). Suitable for use in Shift and Super Shift Assays. Researchers should empirically determine the suitability of the NFkB, Consensus Oligonucleotide for an application not listed in the data sheet. Researchers commonly develop new applications and it is an integral, important part of the investigative research process. It is sometimes possible for the material contained within the vial of "NFkB, Consensus Oligonucleotide, Peptide" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
