ZYG11B cdna clone
ZYG11B cDNA Clone
Gene Names
ZYG11B; ZYG11
Synonyms
ZYG11B; ZYG11B cDNA Clone; ZYG11B cdna clone
Sequence
atggaaaaaacaaagccagaaattttaaagcttgtggttactgggatgagaaaccaccctatgaatttgccagtgcaactggctgcaagcgcctgtgtatttaacttaaccaagcaggatcttgctgcaggaatgcctgtccgactcctggctgatgtgacccatttgctgctcaaagccatggaacattttcccaatcaccagcagttacagaagaattgcctcctttcactttgcagtgaccggatccttcaagatgttccatttaacaggtttgaagcagccaagcttgtcatgcagtggctttgcaaccatgaggatcaaaacatgcaaaggatggcagttgctatcatttctatcctggctgccaagctttctacagaacaaactgcacagcttggtactgagctcttcattgtcaggcaacttcttcaaatagtgaagcagaaaaccaatcaaaattcagtggacactacattgaaatttactttgagtgcactttggaacctcacagatgaatctccaaccacttgtagacactttattgaaaaccaagggttagaactcttcatgagggttctagagtctttcccaactgagtcatccattcagcagaaagttctaggacttttgaacaatatagctgaagtacaagaattacattctgaattaatgtggaaagattttatagaccacatcagtagtctcctacacagtgtggaagtggaagtcagttactttgcagctggaattattgcccatttaatatccagaggtgaacaagcttggacattgagtcgtagccagaggaattctctgctggatgatttgcattcagctattttgaaatggccaactccagagtgtgagatggtagcatacaggtcctttaatccatttttcccattacttggctgtttcacaacaccaggagttcagctatgggcagtttgggccatgcaacatgtctgcagcaagaatccttcaaggtattgcagcatgctgattgaagaaggaggattgcagcatttatacaacatcaaagatcatgaacatactgatccccatgtccaacagattgctgtggccattctggatagcttagaaaaacacattgtgcgccatgggaggccacctccctgtaaaaaacagccccaagccagactaaattga
Sequence Length
1173
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,006 Da
NCBI Official Full Name
Homo sapiens zyg-11 homolog B (C. elegans), mRNA
NCBI Official Synonym Full Names
zyg-11 family member B, cell cycle regulator
NCBI Official Symbol
ZYG11B
NCBI Official Synonym Symbols
ZYG11
NCBI Protein Information
protein zyg-11 homolog B
UniProt Protein Name
Protein zyg-11 homolog B
Protein Family
UniProt Gene Name
ZYG11B
UniProt Synonym Gene Names
KIAA1730
UniProt Entry Name
ZY11B_HUMAN
Uniprot Description
ZYG11B: Probably acts as target recruitment subunit in the E3 ubiquitin ligase complex ZYG11B-CUL2-Elongin BC. Belongs to the zyg-11 family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 1p32.3
Cellular Component: Cul2-RING ubiquitin ligase complex
Molecular Function: ubiquitin-protein ligase activity
Biological Process: regulation of ubiquitin-protein ligase activity
Similar Products
Product Notes
The ZYG11B zyg11b (Catalog #AAA1276290) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaaaaa caaagccaga aattttaaag cttgtggtta ctgggatgag aaaccaccct atgaatttgc cagtgcaact ggctgcaagc gcctgtgtat ttaacttaac caagcaggat cttgctgcag gaatgcctgt ccgactcctg gctgatgtga cccatttgct gctcaaagcc atggaacatt ttcccaatca ccagcagtta cagaagaatt gcctcctttc actttgcagt gaccggatcc ttcaagatgt tccatttaac aggtttgaag cagccaagct tgtcatgcag tggctttgca accatgagga tcaaaacatg caaaggatgg cagttgctat catttctatc ctggctgcca agctttctac agaacaaact gcacagcttg gtactgagct cttcattgtc aggcaacttc ttcaaatagt gaagcagaaa accaatcaaa attcagtgga cactacattg aaatttactt tgagtgcact ttggaacctc acagatgaat ctccaaccac ttgtagacac tttattgaaa accaagggtt agaactcttc atgagggttc tagagtcttt cccaactgag tcatccattc agcagaaagt tctaggactt ttgaacaata tagctgaagt acaagaatta cattctgaat taatgtggaa agattttata gaccacatca gtagtctcct acacagtgtg gaagtggaag tcagttactt tgcagctgga attattgccc atttaatatc cagaggtgaa caagcttgga cattgagtcg tagccagagg aattctctgc tggatgattt gcattcagct attttgaaat ggccaactcc agagtgtgag atggtagcat acaggtcctt taatccattt ttcccattac ttggctgttt cacaacacca ggagttcagc tatgggcagt ttgggccatg caacatgtct gcagcaagaa tccttcaagg tattgcagca tgctgattga agaaggagga ttgcagcatt tatacaacat caaagatcat gaacatactg atccccatgt ccaacagatt gctgtggcca ttctggatag cttagaaaaa cacattgtgc gccatgggag gccacctccc tgtaaaaaac agccccaagc cagactaaat tga. It is sometimes possible for the material contained within the vial of "ZYG11B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
