Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZRANB2 cdna clone

ZRANB2 cDNA Clone

Gene Names
ZRANB2; ZIS; ZIS1; ZIS2; ZNF265
Synonyms
ZRANB2; ZRANB2 cDNA Clone; ZRANB2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgaccaagaatttccgagtcagtgacggggactggatttgccctgacaaaaaatgtggaaatgtaaactttgctagaagaaccagctgtaatcgatgtggtcgggagaaaacaactgaggccaagatgatgaaagctgggggcactgaaataggaaagacacttgcagaaaagagccgaggcctatttagtgctaatgactggcaatgtaaaacttgcagcaatgtgaattgggccagaagatcagagtgtaatatgtgtaatactccaaagtatgctaaattagaagaaagaacaggatatggtggtggttttaatgaaagagaaaatgttgaatatatagaaagagaagaatctgatggtgaatatgatgagtttggacgtaaaaagaaaaaatacagagggaaagcagttggtcctgcatctatattaaaggaagttgaagataaagaatcagagggagaagaagaggatgaggatgaagatctttctaaatataagttagatgaggatgaggatgaagatgacgctgatctctcaaaatataatcttgatgccagtgaagaagaagatagtaataaaaagaaatctaatagacgaagtcgctcaaagtctggatcttcacattcacgatcttcatcacgctcatcctccccctcaagttcaaggtctaggtccaggtcccgttcaagaagttcttccagttcgcagtcaagatctcgttccagttccagagaacgttcgagatctcgtgggtcgaaatcaagatccagctccaggtcccacaggggctcttcttccccacgaaaaagatcttattcaagttcatcatcttctcctgagaggaacagaaagagaagtcgttctagatcttcttcatctggtgatcgcaaaaaaagacgaacaagatcacggtcacccgaaagccaggtgattggtgaaaacactaaacaaccctga
Sequence Length
963
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,318 Da
NCBI Official Full Name
Homo sapiens zinc finger, RAN-binding domain containing 2, mRNA
NCBI Official Synonym Full Names
zinc finger RANBP2-type containing 2
NCBI Official Symbol
ZRANB2
NCBI Official Synonym Symbols
ZIS; ZIS1; ZIS2; ZNF265
NCBI Protein Information
zinc finger Ran-binding domain-containing protein 2
UniProt Protein Name
Zinc finger Ran-binding domain-containing protein 2
UniProt Gene Name
ZRANB2
UniProt Synonym Gene Names
ZIS; ZNF265
UniProt Entry Name
ZRAB2_HUMAN

Uniprot Description

ZNF265: Splice factor required for alternative splicing of TRA2B/SFRS10 transcripts. May interfere with constitutive 5'- splice site selection. Belongs to the ZRANB2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding

Chromosomal Location of Human Ortholog: 1p31

Cellular Component: nucleoplasm; nucleus

Molecular Function: protein binding; RNA binding; transcription factor activity

Research Articles on ZRANB2

Similar Products

Product Notes

The ZRANB2 zranb2 (Catalog #AAA1273996) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgacca agaatttccg agtcagtgac ggggactgga tttgccctga caaaaaatgt ggaaatgtaa actttgctag aagaaccagc tgtaatcgat gtggtcggga gaaaacaact gaggccaaga tgatgaaagc tgggggcact gaaataggaa agacacttgc agaaaagagc cgaggcctat ttagtgctaa tgactggcaa tgtaaaactt gcagcaatgt gaattgggcc agaagatcag agtgtaatat gtgtaatact ccaaagtatg ctaaattaga agaaagaaca ggatatggtg gtggttttaa tgaaagagaa aatgttgaat atatagaaag agaagaatct gatggtgaat atgatgagtt tggacgtaaa aagaaaaaat acagagggaa agcagttggt cctgcatcta tattaaagga agttgaagat aaagaatcag agggagaaga agaggatgag gatgaagatc tttctaaata taagttagat gaggatgagg atgaagatga cgctgatctc tcaaaatata atcttgatgc cagtgaagaa gaagatagta ataaaaagaa atctaataga cgaagtcgct caaagtctgg atcttcacat tcacgatctt catcacgctc atcctccccc tcaagttcaa ggtctaggtc caggtcccgt tcaagaagtt cttccagttc gcagtcaaga tctcgttcca gttccagaga acgttcgaga tctcgtgggt cgaaatcaag atccagctcc aggtcccaca ggggctcttc ttccccacga aaaagatctt attcaagttc atcatcttct cctgagagga acagaaagag aagtcgttct agatcttctt catctggtga tcgcaaaaaa agacgaacaa gatcacggtc acccgaaagc caggtgattg gtgaaaacac taaacaaccc tga. It is sometimes possible for the material contained within the vial of "ZRANB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.